Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof

A molecular marker, nuclear male technology, applied in the field of plant biology, can solve problems such as unfavorable large-scale and batch breeding practice, and achieve the effect of improving the efficiency of trait selection, accurate results and strong specificity

Active Publication Date: 2017-05-17
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF6 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have different degrees of limitations in practicability, detection efficiency or use cost, which is not conducive to large-scale and batch breeding practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof
  • Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof
  • Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Primer Design and Amplified Fragment Analysis of the Rice Recessive Genic Sterile Gene cyp704b2

[0035] 1. Primer design

[0036] Referring to the difference between wild-type CYP704B2 and mutant cyp704b2 gene sequences, a three-primer combination capable of distinguishing recessive nuclear male sterility phenotype and normal fertility phenotype was designed:

[0037] M1907-F 1 : TGTCGGGTTTGGGGTTGAGATAGGG (SEQ ID NO. 1), M1907-F 2 : GGGTTTGGGGTTGAGATCTAAGCT (SEQ ID NO. 2), and M1907-R: AGCGTGACGATGATGTTGGCAGC (SEQ ID NO. 3) (see figure 1 ).

[0038] 2. Analysis of amplified fragments

[0039] Using the above primer combination to amplify the rice recessive male sterility gene cyp704b2, only a 90bp band can be amplified in the sterile material, and a 96bp band can be amplified in the fertile material, or a 96bp and a 96bp band can be amplified at the same time 90bp band. The nucleotide sequences of the 90bp and 96bp bands are shown in SEQ ID NO.4 and SEQ...

Embodiment 2

[0040] Example 2 Identifying the cyp704b2 genotype of rice varieties / lines with molecular markers of the present invention

[0041] 1. Experimental materials

[0042] 1907, Wufeng B, Huazhan, Zhongxiang Huangzhan, R51084, Qingfeng No. 1 B, South H197, Fufenghui 1658, S-127, 9311, Yue 4B, H28B

[0043] 2. Extraction of rice genomic DNA

[0044] Using the CTAB method to extract rice genomic DNA, the specific steps are as follows: take 3 cm long rice leaves at the seedling stage, and extract them in 800 μL of extraction buffer [1.5% (w / v) CTAB, 1.05mol / L NaCl, 75mmol / L Tris-HCl (pH 8.0), 15mmol / L EDTA (pH 8.0)] and collected in a 1.5mL centrifuge tube. Water bath at 65°C for 30 minutes, and mix by inverting occasionally. Add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), and mix by inverting for 15 minutes. Centrifuge at 12000r / min for 10min at room temperature. Aspirate 450 μL of the supernatant, transfer to a new 1.5 mL centrifuge tube, add 2 times the volume of...

Embodiment 3

[0051] Embodiment 3 carries out assisted selection breeding with molecular marker of the present invention

[0052] 1. Experimental materials

[0053] 1907 Homozygous / 1907 Heterozygous Hybrid F 1 Generation 18 single plants, 1907 / 9311 hybrid F 2 Generation segregation population 12 individual plants.

[0054] 2. Extraction of rice genomic DNA

[0055] See Example 2.

[0056] 3. PCR amplification and detection

[0057] Participate in Example 2.

[0058] 4. Results and analysis

[0059] Using the molecular marker of Example 1 of the present invention (specific primer combination M1907-F 1 , M1907-F 2 and M1907-R obtained by PCR amplification) detect the cyp704b2 genotype of 30 individual plants in the present embodiment at the seedling stage, the results are shown in image 3 . 1907 Homozygous / 1907 Heterozygous Hybrid F 1 Of the 18 individual plants in the generation, 6 individual plants only amplified 90bp bands, and 12 individual plants simultaneously amplified 90bp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker for a paddy recessive genic male sterility gene cyp704b2 and application thereof, belonging to the technical field of plant biology. The molecular marker provided by the invention comprises two forward primers SEQ ID NO.1 and SEQ ID NO.2 and one reverse primer SEQ ID NO.3. The molecular marker can be utilized to complete the genetic typing of the paddy recessive genic male sterility gene cyp704b2 on the basis of conventional PCR and PAGE glue electrophoresis. The molecular marker has the advantages of simplicity and convenience in operation, high typing speed, accurate result and low cost, is capable of increasing the selection efficiency of the target trait and can meet the requirements of large-scale molecular marker-assisted selection breeding.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to a molecular marker of rice recessive nuclear male sterility gene cyp704b2 and its application. Background technique [0002] The discovery and utilization of male sterile lines is an important way to increase crop yield and obtain heterosis. At present, the main hybrid breeding methods are "three-line method" and "two-line method". Both of them have played a very important role in increasing crop yield and ensuring national food security, but both have some obvious disadvantages. [0003] For example, the use of the three-line method not only requires the selection of male sterile lines with nuclear-plasma interaction, which is restricted by the relationship between restoration and preservation, but also requires the selection of corresponding maintainer lines and restorer lines to carry out seed propagation and production. The process is complicated, the breeding ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor黄培劲龙湍李佳林唐杰李新鹏张维安保光曾翔吴永忠
OwnerHAINAN BOLIAN RICE GENE TECH CO LTD