Primer sets, probes and kits for Kawasaki disease detection
A Kawasaki disease and reagent technology, applied in the field of primer sets, probes and kits for Kawasaki disease detection, can solve problems such as affecting the specificity of the detection results, and achieve the effect of accurate results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Embodiment 1 detects the reverse transcription primer, amplification primer and probe sequence of Kawasaki disease
[0065] The detection markers of Kawasaki disease are: hsa-miR-197, hsa-miR-671, hsa-miR-1246 and hsa-miR-4436.
[0066] The reverse transcription primer sequence is:
[0067] RT-miR-197:
[0068] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTGGG;
[0069] RT-miR-671:
[0070] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTTTTTTTTTTCCAGCC;
[0071] RT-miR-1246:
[0072] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGCT;
[0073] RT-miR-4436:
[0074] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCAGGGC;
[0075] The amplification primer sequences are:
[0076]Universal reverse primer R-KD: TCGTATCCAGTGCAGGG;
[0077] F-miR-197: TTCACCACCTTTCTCCACC;
[0078] F-miR-671:GAGAGGAAGCCCTGGAG;
[0079] F-miR-1246: GCCGAATGGATTTTTGGAG;
[0080] F-miR-4436: TCCTGTCCACTTCTGCCT;
[0081] The probe sequence is: CCGAGGTATTCGCACTGGAT.
[0082] Among the a...
Embodiment 2
[0083] The detection method of embodiment 2 Kawasaki disease
[0084] (1) Extraction of serum exosome miRNA The operation of extracting serum exosome miRNA includes the following steps:
[0085] 1) Place 250 μl of serum on ice to dissolve naturally, then add 60 μl of exosome extraction reagent, gently blow and mix with a pipette, then let it stand on ice for 30 minutes; centrifuge at 1500g at 4°C for 10 minutes; remove as much as possible with a pipette All supernatants and precipitated parts are exosomes;
[0086] 2) Add 1ml Trizol to the exosome extracted above to fully lyse (mixed by ultrasonic oscillation), and let it stand for 5 minutes;
[0087] 3) Add 200 μl chloroform, shake and mix well for about 30 s, make the aqueous phase and organic phase fully contact, and let stand at room temperature for about 10 min;
[0088] 4) Centrifuge at 14000g for 15min at 4°C, transfer the RNA in the upper aqueous phase to another new RNase-free EP tube;
[0089] 5) Add an equal volu...
Embodiment 3
[0122] Embodiment 3 specificity evaluation experiment
[0123] There are currently 8 Kawasaki disease-specific miRNAs: miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, and miR-134 in serum exosomes of patients with Kawasaki disease and healthy people. The mean difference is significant, which may affect the detection specificity of the primers and probes of the present invention.
[0124] Using miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, miR-13410nM standard cDNA after reverse transcription as a template, using the above-mentioned Example 1 and The primers, probes and methods described in 2 were tested to verify 8 Kawasaki disease-specific miRNAs: miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, Whether miR-134 can be amplified.
[0125] Experimental results such as figure 1 shown. figure 1 Among them, the curves A~H are respectively the cDNA Q- PCR reaction results; from the amplification curve, it can be seen that miR-4739, miR-1...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


