Mammal cell expression promoter and manufacturing and use method thereof
A mammalian and promoter technology, applied in the field of mammalian cell expression promoter, can solve the problems of low expression amount, limited target gene length and short expression time, etc., and achieves prolonged expression time, high tissue specificity, and prolonged expression. amount of effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] The preferred embodiments of the present invention are given below in conjunction with the accompanying drawings to describe the technical solution of the present invention in detail.
[0023] The mammalian cell expression promoter of the present invention is characterized in that it adopts a nucleic acid sequence that is capable of long-lasting and high-level expression of foreign genes in mammalian cells and contains a small number of bases. The involved promoter sequence is as follows: cattgacgtcaat caaaatgtcg taacaactcc gccccattga cgcaaatggg cggtaggcgtgtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat cgcctggaga cgccatccacgctgttttga cctccataga agacaccggg accgatccag cctccgcggc cgggaacggt gcattggaacgcggattccc cgtgccaagagtga(如 Figure 4 shown).
[0024] The method for producing and using the mammalian cell expression promoter of the present invention comprises the following steps:
[0025] Step 1, synthesize primer one by chemical synthesis: 5'-ACGGGGTACCTCACTCTTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



