T3DNA ligase and T4RNA ligase 2 detect n 6 Application of methyladenine

A methyladenine and ligase technology, applied in the field of biological analysis, can solve problems such as low sensitivity, and achieve the effects of high sensitivity, simple operation and good specificity

Active Publication Date: 2019-08-20
SHAANXI NORMAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity of this method is low, and it has not been widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T3DNA ligase and T4RNA ligase 2 detect n  <sup>6</sup> Application of methyladenine
  • T3DNA ligase and T4RNA ligase 2 detect n  <sup>6</sup> Application of methyladenine
  • T3DNA ligase and T4RNA ligase 2 detect n  <sup>6</sup> Application of methyladenine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] T3 DNA ligase detects long non-coding RNA (lncRNA, MALAT1) 2577 site m in HeLa cells 6 The application of A content, the detection principle is as follows figure 1 As shown, the specific detection methods are as follows:

[0038] 1. According to the RNA sequence (RNA2577-A) 5'-CUUAAUGUUUUUGCAUUGG containing the 2577 position of MALAT1 A CUUUGAGUUAAGAUUAUUUUUUUAAAUC CUGAGGACUAGCAUUAAUUGAC-3'(The base underlined is position 2577. In HeLa cells, position 2577 of MALAT1 is part A and part m 6 A) Design and synthesis of left probe (LigaseL2) and right probe (Ligase R2), the base sequence of Ligase L2 is 5'-po 4 CCAATGCAAAAA -3' (The underlined part is the detection recognition area, and the italicized part is the PCR primer area, provided by Bao Bioengineering (Dalian) Co., Ltd.), the base sequence of Ligase R2 is 5'- CTTAACTCAAArGrU -3' (The underlined part is the detection and identification area, and the italicized part is the PCR primer area, provided by Bao Biological Eng...

Embodiment 2

[0048] T3 DNA ligase detects long non-coding RNA (lncRNA, MALAT1) at position 2577 m in HCT116 cells 6 The application of A content, the specific detection method is as follows:

[0049] The probes Ligase L2 and Ligase R2 designed for RNA2577-A in Example 1 were used to detect the content of long non-coding RNA (lncRNA, MALAT1) at 2577 site A in HCT116 cells. The detection method was 106ng / μL HCT116 polyA + RNA replaces HeLa's poly A + For RNA, the other experimental steps are the same as in Example 1, and the real-time fluorescence curve is measured respectively. The detection results are as follows Image 6 Shown. According to the real-time fluorescence curve of RNA2577-A, draw C for detecting RNA2577-A T Value (the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold) and the logarithmic value of RNA2577-A concentration. The result is as follows Figure 7 The amount of adenine (A) at position 2577 of MALAT1 in HCT116 cells was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of ligase in detection of N6 methyladenine, wherein the ligase is T3 DNA ligase or the T4 RNA ligase 2. The invention firstly discovers that the N6 methyladenine (m6A) can inhibit the connection activity of the T3 DNA ligase and the T4 RNA ligase 2 in comparison with adenine (A), based on the characteristic, the RNA (the RNA containing A and the RNA containing m6A) is taken as a template to establish a method for quantitatively determining the m6A percent content based on the ligase-polymerase chain reaction. The method disclosed by the invention is simple in operation, high in sensitivity and good in specificity, the m6A percent content in each of messenger RNA, long non-coding RNA, ribosome RNA, transfer RNA and small RNA and other RNA can be determined.

Description

Technical field [0001] The invention belongs to the field of biological analysis technology, and specifically relates to two pairs of N 6 Methyl adenine (m 6 A) Sensitive ligase, and ligation-polymerase chain reaction based on the ligase to quantitatively detect m in RNA 6 A percentage content method. Background technique [0002] With the development of antibody-high-throughput sequencing methods, scientists have revealed that m 6 A is an important biological function in the organism, but m 6 The mechanism of A is not very clear. For better research m 6 The mechanism of A, the establishment of a specific site with simple, rapid, sensitive, single-base resolution m 6 A analysis and detection methods are of great significance. [0003] Because m 6 A and adenine (A) have a similar chemical structure, accurately locate m 6 The location of A is challenging. Currently existing m 6 Most of the analysis methods of A are high-throughput sequencing methods, and most of these methods can on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6862C12Q1/25
Inventor李正平严景丽刘伟亮
OwnerSHAANXI NORMAL UNIV