T3DNA ligase and T4RNA ligase 2 detect n 6 Application of methyladenine
A methyladenine and ligase technology, applied in the field of biological analysis, can solve problems such as low sensitivity, and achieve the effects of high sensitivity, simple operation and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] T3 DNA ligase detects long non-coding RNA (lncRNA, MALAT1) 2577 site m in HeLa cells 6 The application of A content, the detection principle is as follows figure 1 As shown, the specific detection methods are as follows:
[0038] 1. According to the RNA sequence (RNA2577-A) 5'-CUUAAUGUUUUUGCAUUGG containing the 2577 position of MALAT1 A CUUUGAGUUAAGAUUAUUUUUUUAAAUC CUGAGGACUAGCAUUAAUUGAC-3'(The base underlined is position 2577. In HeLa cells, position 2577 of MALAT1 is part A and part m 6 A) Design and synthesis of left probe (LigaseL2) and right probe (Ligase R2), the base sequence of Ligase L2 is 5'-po 4 CCAATGCAAAAA -3' (The underlined part is the detection recognition area, and the italicized part is the PCR primer area, provided by Bao Bioengineering (Dalian) Co., Ltd.), the base sequence of Ligase R2 is 5'- CTTAACTCAAArGrU -3' (The underlined part is the detection and identification area, and the italicized part is the PCR primer area, provided by Bao Biological Eng...
Embodiment 2
[0048] T3 DNA ligase detects long non-coding RNA (lncRNA, MALAT1) at position 2577 m in HCT116 cells 6 The application of A content, the specific detection method is as follows:
[0049] The probes Ligase L2 and Ligase R2 designed for RNA2577-A in Example 1 were used to detect the content of long non-coding RNA (lncRNA, MALAT1) at 2577 site A in HCT116 cells. The detection method was 106ng / μL HCT116 polyA + RNA replaces HeLa's poly A + For RNA, the other experimental steps are the same as in Example 1, and the real-time fluorescence curve is measured respectively. The detection results are as follows Image 6 Shown. According to the real-time fluorescence curve of RNA2577-A, draw C for detecting RNA2577-A T Value (the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold) and the logarithmic value of RNA2577-A concentration. The result is as follows Figure 7 The amount of adenine (A) at position 2577 of MALAT1 in HCT116 cells was...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com