Method for detecting miRNA by ultra-branch rolling circle amplification triggered by connection reaction

A technology of rolling circle amplification and ligation reaction, applied in the fields of molecular biology and nucleic acid chemistry, which can solve problems such as unsatisfactory ligation efficiency and impact on detection sensitivity, so as to avoid the interference of background fluorescent signals, improve ligation efficiency, and improve sensitivity Effect

Inactive Publication Date: 2017-06-13
WUHAN UNIV
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But before this, it is necessary to connect the padlock probe to form a circle as the template for amplification, so the efficiency of the ligation reaction is also an important factor affecting the detection sensitivity.
In previous studies, T4 DNA ligase was widely used, but the ligation efficiency was not very satisfactory in the ligation reaction where miRNA was used as a template to ligate padlock probes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting miRNA by ultra-branch rolling circle amplification triggered by connection reaction
  • Method for detecting miRNA by ultra-branch rolling circle amplification triggered by connection reaction
  • Method for detecting miRNA by ultra-branch rolling circle amplification triggered by connection reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] In this example, miRNA21 (sequence 5'-uagcuuaucagacugauguuga-3') was used as the detection target.

[0027] 1. Design and synthesis of 5' phosphorylated padlock probe P-21 and secondary primer S-1

[0028] (1) The sequence of the phosphorylated padlock probe P-21 at the 5' end is:

[0029] 5'- CTGATAAGCTA TTTGCATTTCAGTTTACGGTTTAGCATTTCGCAATTTT TCAACATCAGT -3'.

[0030] Among them, the underlined sequences at both ends can be complementary paired with miRNA21 (miR-21), respectively, and there is a sequence in the middle with a length of 38 bases.

[0031] (2) The sequence of the secondary primer S-1 is: 5'-AGTCTGATAAGCTA TTTGCA-3', which is identical to the partial sequence of the phosphorylated lock probe, and can be complementary to the linear rolling circle amplification product, thereby triggering hyperbranched rolling circle amplification. increase.

[0032] 2. Detection of miRNA21

[0033] (1) Ligation reaction

[0034] In 10μL ligation reaction system, ad...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting miRNA by ultra-branch rolling circle amplification triggered by a connection reaction, and belongs to the field of molecular biology and nucleic acid chemistry. The method is mainly composed of three parts, wherein the first part is to mutually supplement and pair two terminals of a lock type probe of 5'end phosphorylation and a target marker minRNA, and then connect them by a SplintR ligase to be a ring; the second part is an ultra-branch roll ring amplification; after the lock type probe is used as a template after forming to be a ring, the target market miRNA is used as a primer; under the function of phi 29 DNA polymerase, the linear roll ring amplification is generated; through introducing a second-grade primer, the linear roll ring amplification is expanded along a branch chain direction, so as to further amplify the signal; the third part is to add SYBR GREEN I dye in the roll ring amplification product to detect. The method is simple in operation, low in cost, single in system, high in sensitivity, free from the background fluorescence signal disturbance, and suitable for detecting miRNA in a complex biotic environment.

Description

technical field [0001] The invention belongs to the fields of molecular biology and nucleic acid chemistry, and in particular relates to a method for detecting miRNA by hyperbranched rolling circle amplification triggered by a ligation reaction. Background technique [0002] miRNA (microRNA) is a class of non-coding single-stranded ribonucleic acid molecules encoded by endogenous genes with a length of about 18-25 nucleotides, which participate in post-transcriptional gene expression regulation in animals and plants. miRNA and siRNA have similar lengths, and both are cut by Dicer enzyme. But the difference is that the mature miRNA is processed once by the original pri-miRNA to form pre-miRNA (microRNA precursor), and then processed to form mature miRNA. These processing processes require Dorsha enzyme and Dicer enzyme. In terms of biological function, the complete complementary pairing of miRNA and target messenger RNA will lead to the degradation of the messenger RNA of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/682C12Q2525/207C12Q2531/125C12Q2563/107C12Q2533/107
Inventor周翔刘奕侬王少儒田沺张小娥黄俊捷杨伊文
OwnerWUHAN UNIV