Kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675)
A micro-ribonucleic acid, semi-quantitative technology, applied in the fields of medicine and molecular biology, can solve the problems of high price, long time, low sensitivity, etc., and achieve the effects of high specificity, easy operation and short detection time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Semi-quantitative analysis of mircroRNA675 standards with different contents.
[0035] Step 1: Probe design and secondary structure prediction. The nucleotide sequence of mircroRNA675 is SEQ ID NO.3: 5'CTGTATGCCCCTCACCGCTCA 3'. The nucleotide sequence of chain A is SEQ ID NO.1: 5'ROX- G L C L C L TCGG TGAGCGGTGAGGGCATACAG CCGAGGCT (-BHQ2)CTCCAGACGTCACTCAGTGCACC-3', the nucleotide sequence of the B chain is SEQ ID NO.2: 5'-GGTGCACTGAGTGACGTCTGGAG
[0036] AG-3'. The single underlined sequence is complementary, the 5' end is modified with ROX (red fluorescent group), the double underlined T is modified with BHQ2 (fluorescent quencher group), the nucleotide with the upper right corner marked L is a locked nucleic acid, and the modification of a locked nucleic acid It is only used to increase the thermal stability of the probe's initial structure and reduce background fluorescence, and has no other effects. The prediction results of the secondary structure of cha...
Embodiment 2
[0044] Examining the Specificity of the Method Using High Concentration Single-base Mismatched Sequences
[0045] Step 1: mircroRNA675 probe design and synthesis, see Step 1 and Step 2 of Example 1, the single-base mismatch nucleotide sequence is SEQ ID NO.4: 5' CTGTATGC T CTCACCGCTCA 3', compared with the mircroRNA675 sequence, only one base T is different;
[0046] Step 2: Take 1 μL of probe with a concentration of 10 μmol / L and 18 μL of hybridization buffer, totaling 19 μL, mix well and add to 200 μL milky white octal tube;
[0047]Step 3: Add 1 μL of mircroRNA675 standard substance to sample well A to make the content of mircroRNA675 in the sample 1 pmol; add 1 μL of single-base mismatch template to sample well B to make the content of single-base mismatch template in the sample The content is 100pmol, and the total volume of the two samples is 20 μL, that is, there is only a single base mismatch template in the B sample that is 100 times higher than that in the A hole, a...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com