Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675)

A micro-ribonucleic acid, semi-quantitative technology, applied in the fields of medicine and molecular biology, can solve the problems of high price, long time, low sensitivity, etc., and achieve the effects of high specificity, easy operation and short detection time.

Inactive Publication Date: 2017-06-13
中国医科大学
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional microRNA detection methods include Northern Blotting and the combined application of reverse transcription and real-time quantitative PCR (realtime PCR). These methods are relatively mature and widely used, but they are cumbersome, expensive, and time-consuming. Long, low sensitivity, prone to false positive results and other defects, it is increasingly unable to meet the current detection needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675)
  • Kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675)
  • Kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Semi-quantitative analysis of mircroRNA675 standards with different contents.

[0035] Step 1: Probe design and secondary structure prediction. The nucleotide sequence of mircroRNA675 is SEQ ID NO.3: 5'CTGTATGCCCCTCACCGCTCA 3'. The nucleotide sequence of chain A is SEQ ID NO.1: 5'ROX- G L C L C L TCGG TGAGCGGTGAGGGCATACAG CCGAGGCT (-BHQ2)CTCCAGACGTCACTCAGTGCACC-3', the nucleotide sequence of the B chain is SEQ ID NO.2: 5'-GGTGCACTGAGTGACGTCTGGAG

[0036] AG-3'. The single underlined sequence is complementary, the 5' end is modified with ROX (red fluorescent group), the double underlined T is modified with BHQ2 (fluorescent quencher group), the nucleotide with the upper right corner marked L is a locked nucleic acid, and the modification of a locked nucleic acid It is only used to increase the thermal stability of the probe's initial structure and reduce background fluorescence, and has no other effects. The prediction results of the secondary structure of cha...

Embodiment 2

[0044] Examining the Specificity of the Method Using High Concentration Single-base Mismatched Sequences

[0045] Step 1: mircroRNA675 probe design and synthesis, see Step 1 and Step 2 of Example 1, the single-base mismatch nucleotide sequence is SEQ ID NO.4: 5' CTGTATGC T CTCACCGCTCA 3', compared with the mircroRNA675 sequence, only one base T is different;

[0046] Step 2: Take 1 μL of probe with a concentration of 10 μmol / L and 18 μL of hybridization buffer, totaling 19 μL, mix well and add to 200 μL milky white octal tube;

[0047]Step 3: Add 1 μL of mircroRNA675 standard substance to sample well A to make the content of mircroRNA675 in the sample 1 pmol; add 1 μL of single-base mismatch template to sample well B to make the content of single-base mismatch template in the sample The content is 100pmol, and the total volume of the two samples is 20 μL, that is, there is only a single base mismatch template in the B sample that is 100 times higher than that in the A hole, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for directly performing semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675), which is used for performing semi-quantitative detection on a certain microRNA675 (micro Ribonucleic Acid 675) in total RNA. The kit for performing the semi-quantitative detection on the microRNA675 (micro Ribonucleic Acid 675) comprises a probe with 'a single-side 3'suspension end double helix structure which is maintained by a multifunctional stem-loop structure' and a hybridization buffering solution which contains a DNA chain replacement enzyme; the probe with the 'single-side 3'suspension end double helix structure which is maintained by the multifunctional stem-loop structure' is formed by assembling an oligonucleotide single chain A and an oligonucleotide single chain B with different lengths; the chain A is longer, and the chain B is shorter. According to the kit for directly performing the semi-quantitative detection on microRNA675 (micro Ribonucleic Acid 675), an original sample, namely, a total microRNA675 (micro Ribonucleic Acid 675) extracting liquid, is directly added into a detecting system without performing reverse transcription and amplification on the microRNA675 (micro Ribonucleic Acid 675); the detecting limit is low; the detecting time is short; the kit is applied to the fields of medicines and molecular biology.

Description

technical field [0001] The invention relates to a kit for semi-quantitating microRNA 675 (microRNA675) directly in the technical fields of medicine and molecular biology. Background technique [0002] MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides, which plays an important role in important physiological and pathological processes such as cell development, apoptosis, differentiation, and proliferation. Studies have found that microRNAs widely exist in human body fluids such as blood, urine, saliva, amniotic fluid, and ascites. The specific microRNA expression profile is one of the specific biomarkers of tumor cells, and it is a new non-invasive diagnostic marker to help the prediction, diagnosis and prognosis of diseases. Traditional microRNA detection methods include Northern Blotting and the combined application of reverse transcription and real-time quantitative PCR (realtime PCR). These methods are relatively mature and widel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6818C12Q2525/207C12Q2565/101C12Q2537/1376C12Q2563/107
Inventor 魏敏杰张晶吴慧哲陈秋晨
Owner 中国医科大学
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com