Unlock instant, AI-driven research and patent intelligence for your innovation.

High signal-noise ratio multi-probe PCR Taqman probe and application thereof

A multi-probe and probe technology, applied in the field of molecular biology, can solve problems such as doubling costs, and achieve the effects of promoting development, enhancing inhibition efficiency, and expanding the range of fluorescent signals

Active Publication Date: 2017-06-20
GWP BIOTECHNOLOGIES INC
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The probe of this invention changed the design method of placing the fluorescent reporter group and the fluorescent quenching group at both ends of the probe in the traditional Taqman probe, and designed the fluorescent quenching group in the middle of the probe. Both ends of the killing group are modified with a fluorescent reporter group. When the probe molecule of the invention is hydrolyzed, two molecules of fluorescence can be released, which can enhance the intensity of the fluorescence signal and improve the sensitivity of detection, but its cost is also doubled, and the background The noise is not weakened, and even stronger, so it is necessary to develop a multiplex PCR Taqman probe with high signal-to-noise ratio to improve the sensitivity of multiplex fluorescent quantitative PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High signal-noise ratio multi-probe PCR Taqman probe and application thereof
  • High signal-noise ratio multi-probe PCR Taqman probe and application thereof
  • High signal-noise ratio multi-probe PCR Taqman probe and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The background noise contrast of embodiment 1 special probe and common probe PCR detection

[0030] For the same HPV45 type, add common probes and special probes with the same gradient concentration, and explore the background signal intensity and background signal intensity of the common probes and special probes at the same concentration.

[0031] Common probe: FAM-5'-caagaaagacttcgcagacgtagggaacac-3'-BHQ;

[0032] Special probe: 5'-caagaaaga(FAM)cttcgcagacgt(BHQ)aggaacac-3';

[0033] In the special probe of Example 1, the quenching group BHQ is labeled on the base T, and the fluorescent group FAM is labeled on the upstream base A of the quenching group, and the distance from the quenching group BHQ is 12 nt.

[0034] refer to figure 1 , the background noise of special probes is significantly lower than that of ordinary probes at the same concentration, and the background noise of ordinary probes rises rapidly with the increase of probe concentration and reaches a p...

Embodiment 2

[0037] Embodiment 2 special probe and common probe PCR detection signal interval comparison

[0038] For the same HPV subtype, add the same concentration of special probes and ordinary probes, perform fluorescence quantitative PCR with the same number of cycles, and compare the signal interval from the beginning of PCR to the end of PCR. For the same HPV58 type (subtype 1) Add separately:

[0039]Common probe: FAM-5'-tttcaattcgatttcatgcac-3'-BHQ;

[0040] Special probe: 5'-tt(FAM)tcaattcgat(BHQ)ttcatgcac-3';

[0041] For the same HPV33 type (subtype 2), respectively add:

[0042] Common probe: TAMRA-5'-actatacacaacattgaactacagtgcgtggaatgc-3'-BHQ;

[0043] Special probe 1: 5'-actatacacaacattg(TAMRA)aactacagtgcgtggaat(BHQ)gc-3';

[0044] In the two special probes of Example 2, the quenching group BHQ is marked on the base T, and the fluorescent group FAM in the HPV58 special probe is marked on the base T upstream of the quenching group, and The distance from the quencher gr...

Embodiment 3

[0048] The effect of embodiment 3 special probes in multi-probe PCR

[0049] 9 HPV subtypes including HPV31, 33, 39, 45, 51, 52, 56, 58, and 66 are simultaneously detected in the FAM channel, using special probe sets and common probe sets for detection, of which the special probe set The four subtypes of HPV31, 33, 45 and 52 are detected by the special probes of the present invention and the rest are detected by common probes. Among them, the special probes corresponding to HPV31, 33, 45 and 52 are:

[0050] HPV31 specific probe: 5'-catagtatt(FAM)ttgtgcaaacctacagacgccatgt(BHQ)-3';

[0051] HPV33 specific probe: 5'-actatacacaacattgaacta(FAM)cagtgcgt(BHQ)ggaatgc-3';

[0052] HPV45 specific probe: 5'-caagaa(FAM)agacttcgcagacgt(BHQ)agggaaacac-3';

[0053] HPV52 specific probe: 5'-aacacag(FAM)tgtagctaacgcacggccat(BHQ)gt-3'.

[0054] The quenching groups BHQ of the four special probes in Example 3 are all marked on the base T, and in the special probes for HPV31, HPV33, HPV45 and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-probe PCR Taqman probe. The Taqman probe is an oligonucleotide sequence which is labeled with a fluorescence group and a quenching group, wherein the oligonucleotide sequence comprises at least one base T; the quenching group is labeled on the base T; and the fluorescence group is labeled on an upstream base of the quenching group and is 8-25nt away from the quenching group. According to the multi-probe PCR Taqman probe provided by the invention, by changing and shortening labeled positions of the fluorescence group and the quenching group and by labeling the quenching group on the base T of the oligonucleotide sequence of the probe, the inhibiting efficiency of the quenching group on the fluorescence group can be obviously enhanced and background noise can be reduced; especially, the probe, when applied to multi-probe PCR, can remarkably reduce background superposed noise, widen a signal interval and improve a signal-noise ratio and detection sensitivity, so that data repeatability is enhanced; and furthermore, the development of multi-probe PCR technology is promoted, detection efficiency is improved and reaction cost is reduced.

Description

technical field [0001] The present invention relates to the field of molecular biology. More specifically, the present invention relates to a high signal-to-noise ratio multi-probe PCRTaqman probe and its application. Background technique [0002] Fluorescent quantitative PCR is a quantitative experimental technology that uses fluorescent dyes or fluorescent-labeled specific probes to mark and track PCR products and monitor the reaction process online in real time. Multi-probe fluorescent quantitative PCR is to perform PCR reaction and fluorescence detection with multiple pairs of probes for multiple specific target sequences in the same PCR reaction system. [0003] At present, the most widely used probe for fluorescent quantitative PCR is Taqman probe, which is an oligonucleotide, the 5' end of the probe is modified with a reporter fluorescent group, and the 3' end is modified with a quencher fluorescent group. When the probe is intact, the fluorescent signal emitted by ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/70C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/708C12Q2600/16C12Q2531/113C12Q2561/101C12Q2537/143
Inventor 郑岷雪马勇赵国栋
Owner GWP BIOTECHNOLOGIES INC