High signal-noise ratio multi-probe PCR Taqman probe and application thereof
A multi-probe and probe technology, applied in the field of molecular biology, can solve problems such as doubling costs, and achieve the effects of promoting development, enhancing inhibition efficiency, and expanding the range of fluorescent signals
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The background noise contrast of embodiment 1 special probe and common probe PCR detection
[0030] For the same HPV45 type, add common probes and special probes with the same gradient concentration, and explore the background signal intensity and background signal intensity of the common probes and special probes at the same concentration.
[0031] Common probe: FAM-5'-caagaaagacttcgcagacgtagggaacac-3'-BHQ;
[0032] Special probe: 5'-caagaaaga(FAM)cttcgcagacgt(BHQ)aggaacac-3';
[0033] In the special probe of Example 1, the quenching group BHQ is labeled on the base T, and the fluorescent group FAM is labeled on the upstream base A of the quenching group, and the distance from the quenching group BHQ is 12 nt.
[0034] refer to figure 1 , the background noise of special probes is significantly lower than that of ordinary probes at the same concentration, and the background noise of ordinary probes rises rapidly with the increase of probe concentration and reaches a p...
Embodiment 2
[0037] Embodiment 2 special probe and common probe PCR detection signal interval comparison
[0038] For the same HPV subtype, add the same concentration of special probes and ordinary probes, perform fluorescence quantitative PCR with the same number of cycles, and compare the signal interval from the beginning of PCR to the end of PCR. For the same HPV58 type (subtype 1) Add separately:
[0039]Common probe: FAM-5'-tttcaattcgatttcatgcac-3'-BHQ;
[0040] Special probe: 5'-tt(FAM)tcaattcgat(BHQ)ttcatgcac-3';
[0041] For the same HPV33 type (subtype 2), respectively add:
[0042] Common probe: TAMRA-5'-actatacacaacattgaactacagtgcgtggaatgc-3'-BHQ;
[0043] Special probe 1: 5'-actatacacaacattg(TAMRA)aactacagtgcgtggaat(BHQ)gc-3';
[0044] In the two special probes of Example 2, the quenching group BHQ is marked on the base T, and the fluorescent group FAM in the HPV58 special probe is marked on the base T upstream of the quenching group, and The distance from the quencher gr...
Embodiment 3
[0048] The effect of embodiment 3 special probes in multi-probe PCR
[0049] 9 HPV subtypes including HPV31, 33, 39, 45, 51, 52, 56, 58, and 66 are simultaneously detected in the FAM channel, using special probe sets and common probe sets for detection, of which the special probe set The four subtypes of HPV31, 33, 45 and 52 are detected by the special probes of the present invention and the rest are detected by common probes. Among them, the special probes corresponding to HPV31, 33, 45 and 52 are:
[0050] HPV31 specific probe: 5'-catagtatt(FAM)ttgtgcaaacctacagacgccatgt(BHQ)-3';
[0051] HPV33 specific probe: 5'-actatacacaacattgaacta(FAM)cagtgcgt(BHQ)ggaatgc-3';
[0052] HPV45 specific probe: 5'-caagaa(FAM)agacttcgcagacgt(BHQ)agggaaacac-3';
[0053] HPV52 specific probe: 5'-aacacag(FAM)tgtagctaacgcacggccat(BHQ)gt-3'.
[0054] The quenching groups BHQ of the four special probes in Example 3 are all marked on the base T, and in the special probes for HPV31, HPV33, HPV45 and...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


