Cas protein specific binding target DNA, method for regulating and controlling target gene transcription and kit

A kit and protein technology, applied in the field of Cas protein binding to DNA, to achieve the effect of simple process

Inactive Publication Date: 2017-07-25
SHANGHAI TOLO BIOTECH CO LTD +1
View PDF2 Cites 45 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problem that existing technical solutions cannot quickly and conveniently bind proteins to multiple target sites on the genome, the present invention provides a new method and kit for binding Cas proteins to DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas protein specific binding target DNA, method for regulating and controlling target gene transcription and kit
  • Cas protein specific binding target DNA, method for regulating and controlling target gene transcription and kit
  • Cas protein specific binding target DNA, method for regulating and controlling target gene transcription and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: For the E. coli lacZ gene, using ddCpf1 and different promoter regions, template chains, Non-template crRNA for transcriptional regulation

[0050] Step 1. Construct the expression plasmid of crRNA

[0051] Reference figure 2 The PAM (protospacer adjacent motifs) site TTN of Cpf1 was found on the coding and non-coding strands of the lacZ gene of E. coli MG1655 genome, and the corresponding direct repeat (DR, AsCpf1) was designed according to the site. Repetitive sequence, SEQ ID No. 38) and guide sequence (T1, T2, T3, NT1, NT2).

[0052] The expression vector pTC17014r of crRNA was constructed. Using pgRNA-bacteria (refer to Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of GeneExpression. Qi LS, etc.. Cell.2013,152(5):1173-83.) as a template, using primers (BsmBI-gRNA- f / BsmBI-gRNA-r2, SEQ ID No.3-4) for PCR amplification, and then recover the PCR product, perform DpnI treatment to remove the original plasmid template, and then use...

Embodiment 2

[0063] Example 2: Regarding multiple genes of E. coli, using ddCpf1 and crRNA array for transcriptional regulation

[0064] Except for Step 1, it is the same as in Example 1.

[0065] In this embodiment, step 1 is to select a guide sequence of ddCpf1 on the template strands of malT, proP, degP, and rseA genes respectively. See Table 2 for details.

[0066] Table 2. Guide sequences designed for different genes

[0067] gene Wizard sequence malT cacagtgaagtgattaactatgc SEQ ID No. 21 proP ttgcttacgcattaggtaaagtt SEQ ID No. 22 degP gcgttatctccgctctctgcaac SEQ ID No. 23 rseA atggatggcgaaacgctggatag SEQ ID No. 24

[0068] Design PCR primers for the four guide sequences: malTcrRNA-TF / malTcrRNA-TR (malT gene guide sequence), proPcrRNA-TF / proPcrRNA-TR (proP gene guide sequence), degPcrRNA-TF / degPcrRNA-TR (degP gene guide sequence) And rseAcrRNA-TF / rseAcrRNA-TR (rseA gene guide sequence); respectively annealed, and the obtained 4 fragments were connected to the vector after pTC17014r p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for binding Cas protein to DNA, and in particular to a method which is capable of conveniently, rapidly and efficiently regulating and controlling gene transcription for one or more targets as well as a kit applicable to the method. The method comprises the following steps: determining a target on genome, finding out a PAM site required by binding of the Cas protein (the Cas protein is a Cas protein mutant having an RNA enzymatic activity and in lack of a DNA enzymatic activity) within left and right regions of the target, designing a go-ahead sequence in accordance with the PAM site, determining direct repeat of the Cas protein and constructing crRNA plasmid for transcribing a crRNA sequence, connected to the go-ahead sequence, of the direct repeat; and promoting co-expression of an encoding gene of the Cas protein and the transcription crRNA plasmid in cells, so that the specific binding of the Cas protein to the target is achieved. With the application of the method provided by the invention, transcription of one or more target genes can be inhibited; and the method, in comparison with CRISPR / dCas9, is quite simple in entire operating process and is equivalent to dCas9 in editing efficiency.

Description

Technical field [0001] The present invention relates to a method for Cas protein to bind DNA, application of the method and a kit, in particular to a method that can conveniently, quickly and efficiently perform gene transcription regulation for one or more targets, and use For the method. Background technique [0002] With the advancement of molecular biology, one of the scientists' work is dedicated to the development of new technologies for modifying and manipulating the genome. Among them, the genome editing technology based on CRISPR / Cas9 protein has shown strong application prospects. Generally speaking, precise genome editing or regulation at the DNA level requires two main components: a DNA binding domain to mediate the recognition and binding of specific sequences, and an effector domain to realize DNA cutting or regulating transcription . Cas9 protein is an RNA-guided endonuclease. This RNA binds to the target DNA by base pairing. In addition, Cas9 interacts with the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/70
Inventor成秋香
OwnerSHANGHAI TOLO BIOTECH CO LTD