Cas protein specific binding target DNA, method for regulating and controlling target gene transcription and kit
A kit and protein technology, applied in the field of Cas protein binding to DNA, to achieve the effect of simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: For the E. coli lacZ gene, using ddCpf1 and different promoter regions, template chains, Non-template crRNA for transcriptional regulation
[0050] Step 1. Construct the expression plasmid of crRNA
[0051] Reference figure 2 The PAM (protospacer adjacent motifs) site TTN of Cpf1 was found on the coding and non-coding strands of the lacZ gene of E. coli MG1655 genome, and the corresponding direct repeat (DR, AsCpf1) was designed according to the site. Repetitive sequence, SEQ ID No. 38) and guide sequence (T1, T2, T3, NT1, NT2).
[0052] The expression vector pTC17014r of crRNA was constructed. Using pgRNA-bacteria (refer to Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of GeneExpression. Qi LS, etc.. Cell.2013,152(5):1173-83.) as a template, using primers (BsmBI-gRNA- f / BsmBI-gRNA-r2, SEQ ID No.3-4) for PCR amplification, and then recover the PCR product, perform DpnI treatment to remove the original plasmid template, and then use...
Embodiment 2
[0063] Example 2: Regarding multiple genes of E. coli, using ddCpf1 and crRNA array for transcriptional regulation
[0064] Except for Step 1, it is the same as in Example 1.
[0065] In this embodiment, step 1 is to select a guide sequence of ddCpf1 on the template strands of malT, proP, degP, and rseA genes respectively. See Table 2 for details.
[0066] Table 2. Guide sequences designed for different genes
[0067] gene Wizard sequence malT cacagtgaagtgattaactatgc SEQ ID No. 21 proP ttgcttacgcattaggtaaagtt SEQ ID No. 22 degP gcgttatctccgctctctgcaac SEQ ID No. 23 rseA atggatggcgaaacgctggatag SEQ ID No. 24
[0068] Design PCR primers for the four guide sequences: malTcrRNA-TF / malTcrRNA-TR (malT gene guide sequence), proPcrRNA-TF / proPcrRNA-TR (proP gene guide sequence), degPcrRNA-TF / degPcrRNA-TR (degP gene guide sequence) And rseAcrRNA-TF / rseAcrRNA-TR (rseA gene guide sequence); respectively annealed, and the obtained 4 fragments were connected to the vector after pTC17014r p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


