Three goat MC1R deficient mutants and application thereof

A technology for mutants and defects, applied in the field of goat molecular marker preparation, can solve problems such as impact

Active Publication Date: 2017-08-08
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effects of these natural mutants on coat color traits are based on trait association analysis, and the results are easily affected by ASIP epistasis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Three goat MC1R deficient mutants and application thereof
  • Three goat MC1R deficient mutants and application thereof
  • Three goat MC1R deficient mutants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Construction of eukaryotic expression vectors for wild-type goat melanocortin receptor-1 (gMC1R) and natural mutants

[0075] The results of bioinformatics analysis on gMC1R show that gMC1R has no intron, and the open reading frame of the gMC1R gene (GenBank accession number: XM_013970999.1) is 954bp, encoding 316 amino acids (see the sequence table SEQ ID NO: 1); The receptor protein has 7 transmembrane domains, 3 outer membrane loops and 3 membrane inner loops.

[0076] In this example, the eukaryotic expression vector pcDNA3.1 (purchased from Clontech) was used to construct the gMC1R wild-type plasmid and 8 mutant plasmids. The specific operation was as follows: using an upstream primer containing a Hind III restriction site and a Kozak sequence (CCCAAGCTTGCCACCATGCCTGCACTCGGCTCCC) and the downstream primer (CGCGGATCCTCACCAGGAGCACTGCAGCACC) containing the BamH I restriction site were used to amplify the coding region of the wild-type gMC1R gene by PCR. After loading ...

Embodiment 2

[0078] Ligand affinity test of wild-type gMC1R and mutants

[0079] Before the cells were collected, the cells were washed twice with serum-free medium (purchased from Gibco), and different final concentrations (10 -10 —10 -5 M) Ligand α-MSH (purchased from Bachem Company) and 100,000 cpm radiolabeled ligand 125 I-NDP-MSH (purchased from Peptide Radioactive Iodine Labeling Service Center of the University of Mississippi) (50 μL) was co-incubated at 37°C for 1 h at 37°C to transfect HEK293T cells (purchased from ATCC Company) with gMC1R wild receptors, and after the reaction was terminated, With pre-cooled PBS (137mM NaCl, 2.7mM KCl, 1.4mM KH 2 PO 4 , 4.3 mM Na 2 HPO 4 , pH 7.4) to wash off the unbound markers, add 100 μL of 0.5N NaOH to collect the cells, and use a gamma scintillation counter to measure the receptor binding in the cells 125 The total amount of I-NDP-MSH, that is, the binding ability of the MC1R mutant to the ligand α-MSH. GraphPad Prism5 software was us...

Embodiment 3

[0086] Comparison of cAMP activity of constitutive and inducible signaling molecules produced by wild-type gMC1R and mutants

[0087] Before collecting the cells, wash the cells twice with serum-free medium, and incubate the transfected gMC1R wild receptor and HEK293T cells of mutants were treated for 15min, and then different final concentrations (10 -10 —10 -5 M) α-MSH stimulated the treated cells, incubated at 37°C for 1 hour, put the cell culture plate on ice, discarded the medium, added 0.5N perchloric acid containing 180 μg / mL theophylline to extract intracellular cAMP, and irradiated Immunoassay (RIA) method 15 .Determination of the dose-dependent curve produced by the signal molecule cAMP, and using GraphPadPrism5 software to calculate its zero concentration value (Basal), effective intermediate concentration (EC 50 ) and the maximum concentration value (E max ).

[0088] The results showed that the mutants G255D, C267W and G225D-V265I almost completely lost the a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of goat molecular marker preparation, and in particular relates to three goat MC1R deficient mutants and application thereof. Three deficient mutants are found in a goat MC1R and application thereof, two mutation sites F250V and G255D casing receptor defects both are located in a sixth transmembrane domain, and another mutation site C267W casing the receptor defects is located on a third external loop. The alpha-MSH ligand affinity of the three MC1R deficient mutants is lost, inducible and constitutive cAMP levels are significantly reduced, and inducible and constitutive p-ERK are significantly reduced. The goat MC1R deficient mutants can lead to the fact that a melanin production signal is blocked and the formation of black coat is affected. The molecular marker can be applied to assisted marker selection of goat wool color.

Description

technical field [0001] The invention belongs to the technical field of goat molecular marker preparation, and specifically relates to three goat MC1R deficient mutants and applications thereof. The molecular marker of the present invention is obtained from the gene encoding goat MClR deficient mutant. Background technique [0002] Coat color is one of the main conditions for identifying breeds of livestock and poultry. Coat color is determined by the ratio of eumelanin to pheomelanin. When eumelanin increases, the coat appears black; when pheomelanin increases, the coat appears yellow or red. Two loci -- the Extension and Agouti loci -- regulate the amount of eumelanin and pheomelanin in hair or skin 1 . Among them, the Extension locus encodes melanocortin 1 receptor (MC1R), which is a melanocortin receptor (melanocortin receptors, MCRs) that only exists in melanocytes, and is a family of G protein-coupled receptors Member, with 7 transmembrane domains. Plays a key rol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/72C12Q1/68C12N15/11
CPCC07K14/723C12Q1/6888C12Q2600/124C12Q2600/156
Inventor熊琪陈明新李晓锋索效军张年杨前平陶虎刘洋田宏张鹤山熊军波
OwnerINST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI