Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting precise medication of four kinds of common clinic cardiovascular medicine and special primer

A technology for cardiovascular and cerebrovascular diseases and medicines, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. , high specificity, suitable for promotion and application

Active Publication Date: 2017-08-08
李爱娟
View PDF8 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no precise medication gene detection using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology for aspirin resistance, nitroglycerin resistance, large individual differences in warfarin, and clopidogrel resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting precise medication of four kinds of common clinic cardiovascular medicine and special primer
  • Method for detecting precise medication of four kinds of common clinic cardiovascular medicine and special primer
  • Method for detecting precise medication of four kinds of common clinic cardiovascular medicine and special primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Embodiment 1, the method for detecting 4 kinds of common clinical cardiovascular and cerebrovascular disease drug resistance SNP sites and special primers

[0092] 1. Special primers for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular diseases

[0093] Design specific PCR primers and UEP primers according to aspirin resistance, nitroglycerin resistance, warfarin individual differences, and clopidogrel resistance-related SNP sites: rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285, rs4986893 , using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology to achieve precise drug genetic testing for aspirin resistance, nitroglycerin resistance, large individual differences in warfarin, and clopidogrel resistance.

[0094] Specific PCR primers and UEP primers include:

[0095] rs5918PCR primer 1: ACGTTGGGATGTCTTTTGGGCTCCTGTCTTAC (SEQ ID NO: 1);

[0096] rs5918 PCR p...

Embodiment 2

[0152] Example 2. The method for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular diseases and the application of special primers

[0153] 1. Extraction of template DNA

[0154] The peripheral blood of 5 subjects (all with symptoms such as hypertension and thrombus) was used as samples 1-5 to be tested, and DNA was extracted according to the method of 2-1 of Example 1.

[0155] 2. PCR reaction: same as 2 of embodiment 1.

[0156] 3. Alkaline phosphatase treatment (SAP digestion reaction): the same as 3 of 2 of Example 1.

[0157] 4. Single base extension reaction: the same as 4 of 2 of Example 1.

[0158] 5. Resin purification: the same as the second part of 5 of embodiment 1.

[0159] 6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection:

[0160] Method is identical with embodiment 1 two 6, and result is as shown in table 2 below:

[0161] Table 2 is the SNP site of the sample ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the precise medication of four kinds of common clinic cardiovascular medicine and a special primer. The invention provides the special primer for detecting four kinds of medicine-resistant SNP sites of the four kinds of common clinic cardiovascular medicine. The eight-SNP site detection relevant to aspirin resistance, nitroglycerin resistance, warfarin individual difference, clopidogrel resistance is efficiently completed through once experiment; the precise medication gene detection of aspirin, nitroglycerin, warfarin and clopidogrel is completed by once experiment; the experiment cost is reduced. The PCR primer designed according to each SNP site and the unique UEP primer have high specificity. The method has high application values on guiding the clinic precise medication of aspirin, nitroglycerin, warfarin and clopidogrel, and is suitable for popularization and application.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a method and special primers for detecting four kinds of common clinical cardiovascular and cerebrovascular disease drugs for precision drug use. Background technique [0002] Precision medicine is an important part of precision medicine. Pharmacogenetics and pharmacogenomics studies have confirmed that different patients carry different single nucleotide polymorphisms in genes (such as drug transporter genes, drug metabolism enzyme genes, DNA repair genes), and have different responses to drugs. The curative effect of different patients is also very different. Therefore, from the perspective of drug efficacy, genetic testing can be used to guide precise medication, help doctors to screen out effective treatment options, and make the most correct treatment decisions for patients, which not only saves patients Ineffective medical expenses, but also improve the treatment effec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/106C12Q2600/156
Inventor 李爱娟谢文博赵菁
Owner 李爱娟
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More