Method for detecting precise medication of four kinds of common clinic cardiovascular medicine and special primer
A technology for cardiovascular and cerebrovascular diseases and medicines, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. , high specificity, suitable for promotion and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] Embodiment 1, the method for detecting 4 kinds of common clinical cardiovascular and cerebrovascular disease drug resistance SNP sites and special primers
[0092] 1. Special primers for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular diseases
[0093] Design specific PCR primers and UEP primers according to aspirin resistance, nitroglycerin resistance, warfarin individual differences, and clopidogrel resistance-related SNP sites: rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285, rs4986893 , using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology to achieve precise drug genetic testing for aspirin resistance, nitroglycerin resistance, large individual differences in warfarin, and clopidogrel resistance.
[0094] Specific PCR primers and UEP primers include:
[0095] rs5918PCR primer 1: ACGTTGGGATGTCTTTTGGGCTCCTGTCTTAC (SEQ ID NO: 1);
[0096] rs5918 PCR p...
Embodiment 2
[0152] Example 2. The method for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular diseases and the application of special primers
[0153] 1. Extraction of template DNA
[0154] The peripheral blood of 5 subjects (all with symptoms such as hypertension and thrombus) was used as samples 1-5 to be tested, and DNA was extracted according to the method of 2-1 of Example 1.
[0155] 2. PCR reaction: same as 2 of embodiment 1.
[0156] 3. Alkaline phosphatase treatment (SAP digestion reaction): the same as 3 of 2 of Example 1.
[0157] 4. Single base extension reaction: the same as 4 of 2 of Example 1.
[0158] 5. Resin purification: the same as the second part of 5 of embodiment 1.
[0159] 6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection:
[0160] Method is identical with embodiment 1 two 6, and result is as shown in table 2 below:
[0161] Table 2 is the SNP site of the sample ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com