Method for generating single-stranded product in isothermal amplification system

A constant temperature amplification and product technology, applied in biochemical equipment and methods, microbial measurement/testing, DNA preparation, etc., can solve the problem of inconvenient capture of probes, achieve low cost, fast reaction rate, and overcome technical defects Effect

Inactive Publication Date: 2017-08-18
ZHEJIANG UNIV
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the nucleic acid molecules captured by the probe are often single-stranded. For double-stranded nucleic acid molecules, probe capture is obviously inconvenient.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for generating single-stranded product in isothermal amplification system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Steps for generating a 60nt single-stranded product at 56°C using the CaMV 35S of the transgenic rice KMD1 as a template.

[0035] CaMV 35S template sequence:

[0036] CACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCCACTGACGTAAGGGATGACGCACAATCCCACTATTCCTTCGCAAGACCTCTTCCTTATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGAAATCACCAGTCTCTCTCTAAATCTATCTCTCTC.

[0037] Complementary sequence of CaMV 35S template:

[0038] GAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCACACATCAATCCACTTGCTTTGAAGACGTG.

[0039] Preparation of reagents before reaction: Add 50ul reaction reagents to the PCR tube: 10U Nt.BstNBI, 6U Bst DNAPolymerase, 2.5ul NEBuffer 3, 5ul Thermopol Reaction Buffer, 300uM dNTP, 500nM primers F1 and R1, 50nM primers BF and BR, 2.5 ul template, 50 nM nucleic acid repressor. Incubate at 56°C for 10 minutes.

[0040] The sequences of primers and nucleic acid repressors designed for the CaMV 35S double-stranded template sequence are as follows:

[0041] F1: CTTATTGTCCGAGTCTTATTGACGTAAGGGA...

Embodiment 2

[0066] Example 2: Steps for generating a 43nt single-stranded product at 65°C using CP4 epsps of transgenic soybean GTS 40-3-2 as a template.

[0067] CP4 epsps template sequence:

[0068] TGGGGTTTATGGAAATTGGAATTGGGATTAAGGGTTTGTATCCCTTGTGCCATGTTGTTAATTTGTGCCATTCTTGAAAGATCTGCTAGAGTCAGCTTGTCAGCGTGTCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCTTACGTCACTGGGAGATATCACATGGTTCCACTTGCTTTGAAGACTTACGTG

[0069] Complementary sequence of CP4 epsps template:

[0070] AGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAGCTGACTACTAGCAGATCTTTCATAAGAATGGCACAAATTAACCACCATGGCACAAGGGATACAACCCAT.

[0071] Preparation of reagents before reaction: Add 50ul reaction reagents to the PCR tube: 10U Nb.BsrDI, 9.6U Bst DNAPolymerase, 2.5ul NEBuffer 3, 5ul Thermopol Reaction Buffer, 300uM dNTP, 200nM primers F1 and R1, 50nM primers BF and BR, 2.5ul template, 50nM nuc...

Embodiment 3

[0098] Example 3: Steps for generating a 30nt single-stranded product at 35°C using the 16S rDNA of citrus Huanglongbing HLB as a template.

[0099] 16S rDNA template sequence:

[0100] GGGTTGCCCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCACGTCCCAGTGTGGCTGATCGTCCCTCTCAGACCAGCTATAGATCGTAGCCTTGGTAGGCTCTTACCCTACCAACTAGCTAATCCAACGCAGG.

[0101] Complementary sequence of 16S rDNA template:

[0102] CCTGCGTTGGATTAGCTAGTTGGTAGGGTAAGAGCCTACCAAGGCTACGATCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGCAACCC.

[0103] Preparation of reagents before reaction: Add 50ul reaction reagents to the PCR tube: Add 50ul reaction reagents to the PCR tube: 10U Nt.AlwI, 5U phi29 DNA Polymerase, 2.5ul NEBuffer 3, 5ul Thermopol ReactionBuffer, 300uM dNTP, 200nM primer F1, 1 uM primer R1, 50 nM primers BF and BR, 2.5 ul template, 50 nM nucleic acid repressor. Incubate at 35°C for 10 minutes.

[0104] The sequences of primers and nucleic acid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for generating a single-stranded product in an isothermal amplification system. According to the method for generating the single-stranded product, the isothermal amplification system comprises two pair of primers including F1, R1, BF and BR, wherein each of F1 and B1 includes three parts: a fixed region close to a 5' terminal of the primer, a recognition region which is close to a 3' terminal and capable of specifically bound with a template, and a nickase region between the fixed region and the recognition region. The method has the beneficial effects that the reaction speed is high, the cost is low, the operation is simple and convenient, a single-stranded DNA amplified product can be generated by virtue of an isothermal amplification method, and the technical defects in the background art are overcome.

Description

technical field [0001] The invention belongs to the field of nucleic acid analysis and detection, and in particular relates to a method for generating single-stranded products in a constant temperature amplification system. Background technique [0002] Nucleic acid amplification technology is of great significance in the field of analysis and detection today. Food safety testing, environmental monitoring, medical diagnosis, forensic identification and other fields all rely on nucleic acid amplification technology. The earliest and most classic nucleic acid amplification technology relies on the constant cycling of temperature to achieve template denaturation, primer annealing and extension with the help of heat-resistant polymerase, so as to achieve a large accumulation of target products. This technology is called polymerization. Enzyme chain reaction (PCR). However, the biggest defect of PCR is that its constant temperature change process puts forward relatively high re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/68
CPCC12Q1/6844C12Q2521/101C12Q2521/301C12Q2525/186
Inventor王柳吴坚
OwnerZHEJIANG UNIV