Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof
A detection box, colloidal gold technology, applied in biological testing, material inspection products, etc., can solve the problems of cumbersome and low sensitivity detection of transgenic protein Cry1Ab/Ac, and achieve short detection time, simple operation, on-site and sensitive detection. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0025] First, make test strips
[0026] Two holes are set on the upper plastic board strip, a sampling hole and an observation hole. The size of the sampling hole is 3mm×7mm, and the size of the observation hole is 4mm×18mm. Paste the sample pad, the gold standard pad immobilized with the colloidal gold-labeled specific monoclonal antibody, the cellulose acetate membrane and the absorbent pad side by side under the plastic card strip. Immobilize 40ng anti-digoxigenin antibody on the gold label pad, immobilize 0.8μg anti-FITC antibody on the detection area on the cellulose acetate membrane and immobilize the secondary antibody on the control area. Then place it at 37°C for 30min in vacuum, as figure 1 shown.
[0027] Then, the design of digoxigenin tag sequence, FITC tag sequence
[0028] target nucleic acid
Primer name
sequence
modify
Cry1Ac
Primer 1
GCTCCTACAAATGCCATCATTGC
Cry1Ac
Primer 2
GATAGTGGGATTGTGCGTCATC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



