Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof

A detection box, colloidal gold technology, applied in biological testing, material inspection products, etc., can solve the problems of cumbersome and low sensitivity detection of transgenic protein Cry1Ab/Ac, and achieve short detection time, simple operation, on-site and sensitive detection. Effect

Inactive Publication Date: 2017-10-20
WUXI FUYANG BIOTECH
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is to overcome the defects that the existing method for detecting transgenic protein Cry1Ab/Ac is relatively cumberso...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof
  • Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof
  • Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0025] First, make test strips

[0026] Two holes are set on the upper plastic board strip, a sampling hole and an observation hole. The size of the sampling hole is 3mm×7mm, and the size of the observation hole is 4mm×18mm. Paste the sample pad, the gold standard pad immobilized with the colloidal gold-labeled specific monoclonal antibody, the cellulose acetate membrane and the absorbent pad side by side under the plastic card strip. Immobilize 40ng anti-digoxigenin antibody on the gold label pad, immobilize 0.8μg anti-FITC antibody on the detection area on the cellulose acetate membrane and immobilize the secondary antibody on the control area. Then place it at 37°C for 30min in vacuum, as figure 1 shown.

[0027] Then, the design of digoxigenin tag sequence, FITC tag sequence

[0028] target nucleic acid

Primer name

sequence

modify

Cry1Ac

Primer 1

GCTCCTACAAATGCCATCATTGC

Digoxin

Cry1Ac

Primer 2

GATAGTGGGATTGTGCGTCATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a colloidal gold immunodetection kit for detecting a transgenic protein Cry1Ab/Ac. The colloidal gold immunodetection kit comprises a pretreatment PCR tube and a test paper. The test paper is composed of a sample pad, a label pad, a nitrocellulose membrane and an absorbent pad, and the sample pad, the label pad, the nitrocellulose membrane and the absorbent pad are orderly lap-connected to and bonded to a base plate. The label pad is coated with a colloidal gold-labeled anti-digoxin antibody. The nitrocellulose membrane comprises a detection zone coated with an anti-FITC antibody and a control zone coated with a secondary antibody. The pretreatment PCR tube comprises a digoxin-labeled sequence, a FITC-labeled sequence, a Taq enzyme, dNTP and buffer. The digoxin-labeled sequence is GCTCCTACAAATGCCATCATTGC and the FITC-labeled sequence is GATAGTGGGATTGTGCGTCATCCC. The colloidal gold immunodetection card can realize fast and on-site sensitive detection of the PCR amplification product, is easy to operate, realizes visual inspection of the PCR amplification result and can finish detection in 8-10min.

Description

technical field [0001] The invention relates to a colloidal gold immunoassay box for detecting transgenic protein Cry1Ab / Ac and application thereof. Background technique [0002] The insecticidal crystal protein gene of Bacillus thuringiensis (abbreviated as Bt) has been successfully applied in crops such as cotton and corn. According to the homology of the coding gene sequence and the insecticidal spectrum of the encoded protein, Bt insecticidal crystal proteins are divided into cry family and cryt family, and each class is further divided into different subclasses. The Bt genes currently expressed in plants include Bt cry1Aa, cry1Ab, cry1Ac, cry2Aa, cry3Bb, and cry9c. The BtCry1Ab / Ac protein has a very high similarity, and the BtCry1Ac protein gene in commercial crops currently on the market already contains the BtCry1Ab protein gene. [0003] Immunological detection kits have been widely used in the quality detection of transgenic insect-resistant cotton and corn seeds,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/68
CPCG01N33/68
Inventor 武爱波
Owner WUXI FUYANG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap