Unlock instant, AI-driven research and patent intelligence for your innovation.

A new use of Digi and an antitumor drug

A drug and action technology, applied in the field of antitumor drug preparation, can solve the problems of insufficient research, unclear active ingredients, unclear active sites, and unclear mechanism of action, and achieve excellent clinical application prospects, no toxic side effects, and effects. Mechanistically clear effect

Active Publication Date: 2020-11-17
BEIJING CAPITALBIO PHARMA CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the main bottlenecks in the research and development of anti-tumor traditional Chinese medicines are that the active ingredients and active parts of the medicine are not clear, the mechanism of action is unclear or the research is not thorough enough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new use of Digi and an antitumor drug
  • A new use of Digi and an antitumor drug
  • A new use of Digi and an antitumor drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The real-time quantitative gene amplification fluorescence detection system, that is, the qPCR method, was used to verify the effect of the grass extract on the expression of NFKB2, EGFR, and WNT7B genes. The specific experimental process was as follows:

[0033] 1. Weigh 10g of Di whole grass, add 150mL of 90% ethanol and heat to 85°C, extract for 3h, concentrate and dry to obtain the extract of Di grass. Dissolve the grass extract in DMSO, and treat the cells for 24 hours;

[0034] 2. Use the kit to extract RNA and reverse it to cDNA;

[0035] 3. RT-qPCR reaction, program: 95°C, 3min; (95°C, 3s; 60°C, 30s) 40 cycles.

[0036] Among them, the primer sequence is:

[0037] NFKB2: Upstream primer AGAGGCTTCCGATTTCGATATGG

[0038] Downstream primer GGATAGGTCTTTCGGCCCTTC

[0039] EGFR: Upstream primer AGGCACGAGTAACAAGCTCAC

[0040] Downstream primer ATGAGGACATAACCAGCCACC

[0041] WNT7B: Upstream primer GAAGCAGGGCTACTACAACCA

[0042] Downstream primer CGGCCTCATTGTTATGC...

Embodiment 2

[0049] Using the CCK8 experiment to detect the effect of Di (whole grass) extract on cell proliferation, the specific experimental process is as follows:

[0050] 1. Treat breast cancer MDA-MB-231 cells and breast cancer MCF7 cells for 24 hours with the extract of Di (whole plant) respectively;

[0051] 2. Use CCK8 kit to measure cell viability;

[0052] 3. Calculation of cell viability, inhibition rate, IC 30 , IC 50 .

[0053] The results of CCK8 are shown in Table 2, Table 3 and figure 2 , image 3 .

[0054] Table 2 The effect of Di (whole plant) on the proliferation of MDA-MB-231 cells

[0055]

[0056]Table 3 Effect of Di (whole plant) on the proliferation of MCF7 cells

[0057]

[0058] The results of CCK8 showed that the extract concentration of Di (whole grass) could inhibit the activity of tumor cells in the range of 50-400 μg / mL. IC 30 The value is 160μg / mL, IC 50 The value is about 250μg / mL; IC for MCF7 cells 30 The value is 98μg / mL, IC 50 The va...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of traditional Chinese medicine and discloses new application of herba miscanthi sacchariflori and an antitumor drug. The invention provides the new application of the herba miscanthi sacchariflori in preparing a drug with an anti-tumor effect. According to the invention, by adopting a qPCR experiment, the action mechanism of the qPCR experiment is clarified from a gene level, and the experiment shows that the extract of the herba miscanthi sacchariflori can up-regulate the NFKB2 gene obviously and down-regulate the expression of EGFR and WNT7B genes obviously, and inhibit the tumor cell activity in a range of 50 to 400mug / ml and shows that the herba miscanthi sacchariflori has anti-tumor activity.

Description

technical field [0001] The invention relates to the technical field of traditional Chinese medicines, in particular to a new application of qi and an antitumor drug, in particular to the application of qi in the preparation of antitumor medicaments. Background technique [0002] Tumor is a new organism formed by the body under the action of various tumorigenic factors, cells in local tissues lose control of their growth at the gene level, resulting in monoclonal abnormal proliferation. [0003] With the increase of the proportion of urban population in our country, the rapid development of township industrial production, the increasingly serious environmental pollution, the ubiquity of unhealthy lifestyles and behaviors such as smoking and diet, and the increasing incidence of tumors, it has become a serious threat to human life and Common diseases of health. [0004] At present, there are more than 80 kinds of anti-tumor drugs commonly used in clinical practice in the worl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K36/899A61K45/06A61P35/00
CPCA61K36/899A61K45/06
Inventor 谢兰郭弘妍邢婉丽程京党红蕾
Owner BEIJING CAPITALBIO PHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More