Supercharge Your Innovation With Domain-Expert AI Agents!

Molecular marker Geo168 primers for kiwi Moshan series male cultivar identification and application

A geo168-f and geo168-r technology, applied in the field of molecular marker Geo168 primers, can solve the problems that the molecular marker identification research of kiwifruit male series varieties has not yet been carried out, and achieve the effect of simple and intuitive morphological markers, poor polymorphism, and easy operation

Active Publication Date: 2017-11-07
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, research on molecular marker identification of male kiwifruit serial varieties has not yet been carried out

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker Geo168 primers for kiwi Moshan series male cultivar identification and application
  • Molecular marker Geo168 primers for kiwi Moshan series male cultivar identification and application
  • Molecular marker Geo168 primers for kiwi Moshan series male cultivar identification and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Acquisition of molecular marker Geo168 primers for identification of kiwifruit Moshan series male varieties:

[0019] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). Mining the SSR sites of different repeating units in the whole genome, comparing the gene structure annotation results, and selecting the SSR sites in the gene interval to design amplification primers. Using the designed and synthesized primers, the kiwifruit 'Moshan' series varieties were amplified by PCR, and the molecular marker Geo168 was obtained by screening. The primers designed for it were Geo168-F:AAAATCTTACAAAAATATGCCGA and Geo168-R:TGATTTTCACGGGACTCTGC.

Embodiment 2

[0021] The application of molecular marker Geo168 primers for the identification of kiwifruit Moshan series male varieties in the identification of kiwifruit Moshan varieties:

[0022] (1) According to the CTAB method, the DNA samples of 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshanxiong 4' and 'Moshanxiong 5' were extracted respectively .

[0023] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.

[0024] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.

[0025] (4) In the corresponding wells of the 96-well plate, 5 DNA samples from the Mo Shanxiong series were added, 50pg for each sample.

[0026] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a sealing film, shake, place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop. The PCR reaction was performed accor...

Embodiment 3

[0040] The application of molecular marker Geo168 primers for the identification of kiwifruit male Moshan varieties in the identification of kiwifruit varieties:

[0041] Extract 'Moshanxiong No.1', 'Moshanxiong No.2', 'Moshanxiong No.3', 'Moshanxiong No.4', 'Moshanxiong No.5', 'Chuhong', 'Huaguang No.2' ', 'Xixuan No. 1' or 'Huayou' kiwifruit DNA samples, using the method of Example 2, using Geo168-F:AAAATCTTACAAAAATATGCCGA and Geo168-R:TGATTTTCACGGGACTCTGC. Molecular markers were identified for the above varieties.

[0042]Using the marker Geo168 to amplify Moshan series varieties, it can specifically distinguish 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshan 4', 'Moshanxiong 5 No.', 'Chuhong', 'Huaguang No. 2', 'Xixuan No. 1' or 'Huayou' kiwifruit. The results showed that 'Moshanxiong 1' amplified 2 bands, 225bp and 247bp respectively; 'Moshanxiong 2' amplified 2 bands, respectively 241bp and 249bp; 1 band was amplified, which was 261bp; 'Moshan 4' was amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to molecular marker Geo168 primers for kiwi Moshan series male cultivar identification and application. The molecular marker primers are Geo168-F:AAAATCTTACAAAAATATGCCGA and Geo168-R:TGATTTTCACGGGACTCTGC. By means of the primers, the kiwi Moshan series male cultivar can be precisely distinguished, and other cultivars except the Moshan series male cultivar can also be distinguished, and the primers have identification universality and are suitable for large-scale popularization.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and more specifically relates to molecular marker Geo168 primers for identification of kiwifruit Moshan series male varieties and its application. Background technique [0002] In recent years, my country's kiwifruit industry has steadily expanded. As of 2016, the national cultivation area reached 2.2 million mu, with an output of 2.6 million tons and an output value of more than 20 billion yuan. Kiwifruit belongs to the dioecious type, that is, the pollen in the female flower is aborted, while the ovary is not fully developed and the ovule is aborted in the male flower. Therefore, in kiwifruit breeding and commercial orchard cultivation, it is usually necessary to select pollen from excellent male plants for cross-pollination to achieve kiwifruit fruiting. [0003] In recent years, the 'Moshan' male series of kiwifruit varieties selected and bred by the Wuhan Bota...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 钟彩虹黄宏文张琼张鹏
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com