Construction method of anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid

A CHO-K1 and construction method technology, applied in the field of biopharmaceuticals, can solve the time-consuming and labor-intensive problems of gene knockout, and achieve the effects of good tolerance to apoptosis, increased expression level, and prolonged synthesis time

Inactive Publication Date: 2017-11-24
JIANGNAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Generally, the characteristics of CHO cells are changed by adding or knocking out certain genes in the CHO cell genome. Traditionally, knocking out a gene requires constructing a plasmid containing the relevant sgRNA sequence and co-transfecting it with the Cas9 plasmid into the cell Inside, the gene is knocked out, and the cells are single-clonal deleted. After a series of identifications such as DNA, protein and function are carried out after screening the monoclonal, it is necessary to perform the same operation on the second gene. Therefore, the traditional method is for Gene knockout is time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid
  • Construction method of anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A method for constructing an anti-apoptotic CHO-K1 cell line that can be used in combination with valproic acid to increase the expression level, the method for constructing comprises the following steps:

[0042] (1) Construct the sgRNA sequence of the BAK gene and synthesize the following sequence:

[0043] TTTGGGAAGCCGGTCAAACCACGTGT;

[0044] TAAAACACGTGGTTTGACCGGCTTCC.

[0045] (2) Construct the sgRNA sequence of the BAX gene and synthesize the following sequence:

[0046] T TTGGCTGATGGCAACTTCAACTGGT ;

[0047] TAAAACCAGTTGAAGTTGCCATCAGC.

[0048] (3) Pass the two pairs of sequences obtained in steps (1) and (2) through a high-temperature water bath at 95°C and then slowly cool down to room temperature, and then use T4 ligase at 16°C overnight for the PSK-u6-gRNA carrier digested with BBsI After ligation, single clones were obtained by transforming competent cells, and the new plasmids were PSK-sgRNA-BAK and PSK-sgRNA-BAX respectively.

[0049] (4) After tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of an anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid. The construction method comprises the following steps: firstly, respectively designing out corresponding sgRNA sequences on exons of BAK and a BAX genes; secondly, preparing PSK-sgRNA-BAK and PSK-sgRNA-BAX plasmids; thirdly, transfecting the plasmids into CHO-K1 cells and then screening and selecting monoclone to obtain different cell lines; fourthly, carrying out Western Blot detection; fifthly, carrying out functional identification and verification; sixthly, jointly using an exogenous protein expression cell line constructed by knockout cell lines and the valproic acid to further improve the expression level of the exogenous protein. According to the stable cell line prepared by the method disclosed by the invention, synthetic time of recombinant protein of the stable cell line can be prolonged and more recombinant proteins are obtained.

Description

technical field [0001] The invention relates to the technical field of biopharmaceuticals, in particular to a method for simultaneously knocking out BAK and BAX genes by using CRISPR / Cas9 technology to construct a CHO-K1 cell line with anti-apoptotic properties. Background technique [0002] Chinese Hamster Ovary cell (CHO) is a mammalian cell that is currently widely used to produce various therapeutic proteins. It has many advantages, such as: CHO cells can be used in a chemically defined and serum-free medium It grows vigorously in China, and its genome does not contain human-derived pathogenic viruses and is relatively safe. It can perform post-translational modifications on recombinant proteins similar to human proteins. Through cell engineering of wild-type CHO cells, different cell lines can be obtained to improve the expression level of recombinant proteins in later stable cell lines. [0003] Generally, the characteristics of CHO cells are changed by adding or knoc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/66C12N15/85
CPCC12N15/113C12N15/66C12N15/85C12N2310/10
Inventor周松涛曹啸东金坚
OwnerJIANGNAN UNIV