Unlock instant, AI-driven research and patent intelligence for your innovation.

Wheat anther tapetum-specific expression promoter and its application

A technology of anther tapetum and promoter, applied in the field of genetic engineering, can solve the problems of destroying mitochondrial function, blocking the normal metabolic pathway of anther cells, and difficulty in restoring fertility of sterile lines

Inactive Publication Date: 2020-09-18
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In recent years, many new methods for creating male sterile materials have been developed, such as antisense inhibition, blocking the normal metabolic pathways of anther cells, and destroying mitochondrial functions. However, it is difficult to restore the fertility of the sterile lines obtained by these methods. There is still a long way to go directly to production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat anther tapetum-specific expression promoter and its application
  • Wheat anther tapetum-specific expression promoter and its application
  • Wheat anther tapetum-specific expression promoter and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1, Cloning and sequence motif analysis of TMS1 gene promoter pTMS1

[0014] Wheat variety JING411 was planted in the field of Beijing. After the wheat flag was raised, samples were taken at the pollen mother cell stage (PMC), dyad stage (Dyad), tetrad stage (Tetrad) and mature pollen stage (MP), and placed in the Freeze in liquid nitrogen and store at -80°C for future use. According to the DNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), the total DNA extraction of plant leaf tissue was completed, and then a pair of primers were designed using the extracted total DNA as a template:

[0015] TMS1-F GTCCCTGCTGTGATATCAAGAGC

[0016] TMS1-R CAGGGCAGGTCAGTTCTTGG

[0017]The gene TMS1 was cloned. The length of the TMS1 open reading frame (ORF) was 711bp, encoding 236 amino acids. This gene is a gene family encoding Ole e 1 pollen protein. TMS1 is a new member of the Ole e 1 pollen protein gene family cloned for the first time in wheat. Gene. ...

Embodiment 2

[0024] Example 2, Analysis of expression of TMS1 gene driven by pTMS1 promoter in wheat pollen tapetum

[0025] Wheat JING411 was planted in the fields of Beijing. After the wheat flag was raised, it was collected at the pollen mother cell stage (PMC), dyad stage (Dyad), tetrad stage (Tetrad) and mature pollen stage (MP), and placed in liquid immediately. Freeze in nitrogen and store at -80°C for future use. According to the RNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), the total RNA extraction of the plant leaf tissue was completed, and then the extracted total RNA was used as a template to perform reverse transcription with reverse transcriptase (M-MLV) to obtain the cDNA template for subsequent experiments.

[0026] TMS1-F CCGGAGCCCTCATACGGTA

[0027] TMS1-R GGAAGAACAGCTTCGGGTCG

[0028] Using qRT-PCR to analyze the expression pattern of TMS1 in anthers of different tissues and different developmental stages of JING411, as shown in figure 1 As s...

Embodiment 3

[0039] Example 3, pTMS1 promoter drives GUS gene expression analysis in wheat pollen

[0040] Use BamHI+EcoRI to cut the pBI121 binary vector to isolate GUS+NOS; insert the GUS+NOS fragment behind the pTMS1 promoter, transform the constructed vector into Agrobacterium EHA105, and transform the callus induced by spring wheat Fielder immature embryos to obtain pTMS1 +GUS transgenic plants. After the transformed materials were cultured at 28°C for 16 hours under light conditions, and then continued to grow at 26°C for 48 hours in the dark, the anther chemical detection of GUS activity was carried out according to Jefferson's method. Soak the callus in the prepared X-Gluc solution and keep it overnight at 37°C. The next day, the callus is taken out and decolorized with 50%, 70%, and 100% alcohol in turn. After washing with sterilized distilled water, observe and take pictures. Such as image 3 As shown, the results showed that the anthers were stained blue in the transgenic pla...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to a specific expression promoter of a wheat anther tapetum and an application of the specific expression promoter. The nucleotide sequence of the promoter is as indicated in SEQ No. 1. The promoter can drive a target gene to perform specific expression in pollen.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a wheat anther tapetum-specific expression promoter and application thereof. Background technique [0002] In recent years, many new methods for creating male sterile materials have been developed, such as antisense inhibition, blocking the normal metabolic pathways of anther cells, and destroying mitochondrial functions. However, it is difficult to restore the fertility of the sterile lines obtained by these methods. There is still a long way to go directly to production. Therefore, it is necessary to design a new set of technical routes and create a new male sterile line and a new heterozygous utilization system. The key to the development of the new male sterile line lies in the isolation of plant male organ-specific expression promoters and the construction of expression vectors. [0003] The Ole e 1 pollen protein gene family is a kind of important super gene family that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8231
Inventor 唐益苗赵昌平徐磊苏世超王伟伟房兆峰孙辉张风廷王娜郭春曼
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES