Wheat anther tapetum-specific expression promoter and its application
A technology of anther tapetum and promoter, applied in the field of genetic engineering, can solve the problems of destroying mitochondrial function, blocking the normal metabolic pathway of anther cells, and difficulty in restoring fertility of sterile lines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Example 1, Cloning and sequence motif analysis of TMS1 gene promoter pTMS1
[0014] Wheat variety JING411 was planted in the field of Beijing. After the wheat flag was raised, samples were taken at the pollen mother cell stage (PMC), dyad stage (Dyad), tetrad stage (Tetrad) and mature pollen stage (MP), and placed in the Freeze in liquid nitrogen and store at -80°C for future use. According to the DNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), the total DNA extraction of plant leaf tissue was completed, and then a pair of primers were designed using the extracted total DNA as a template:
[0015] TMS1-F GTCCCTGCTGTGATATCAAGAGC
[0016] TMS1-R CAGGGCAGGTCAGTTCTTGG
[0017]The gene TMS1 was cloned. The length of the TMS1 open reading frame (ORF) was 711bp, encoding 236 amino acids. This gene is a gene family encoding Ole e 1 pollen protein. TMS1 is a new member of the Ole e 1 pollen protein gene family cloned for the first time in wheat. Gene. ...
Embodiment 2
[0024] Example 2, Analysis of expression of TMS1 gene driven by pTMS1 promoter in wheat pollen tapetum
[0025] Wheat JING411 was planted in the fields of Beijing. After the wheat flag was raised, it was collected at the pollen mother cell stage (PMC), dyad stage (Dyad), tetrad stage (Tetrad) and mature pollen stage (MP), and placed in liquid immediately. Freeze in nitrogen and store at -80°C for future use. According to the RNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), the total RNA extraction of the plant leaf tissue was completed, and then the extracted total RNA was used as a template to perform reverse transcription with reverse transcriptase (M-MLV) to obtain the cDNA template for subsequent experiments.
[0026] TMS1-F CCGGAGCCCTCATACGGTA
[0027] TMS1-R GGAAGAACAGCTTCGGGTCG
[0028] Using qRT-PCR to analyze the expression pattern of TMS1 in anthers of different tissues and different developmental stages of JING411, as shown in figure 1 As s...
Embodiment 3
[0039] Example 3, pTMS1 promoter drives GUS gene expression analysis in wheat pollen
[0040] Use BamHI+EcoRI to cut the pBI121 binary vector to isolate GUS+NOS; insert the GUS+NOS fragment behind the pTMS1 promoter, transform the constructed vector into Agrobacterium EHA105, and transform the callus induced by spring wheat Fielder immature embryos to obtain pTMS1 +GUS transgenic plants. After the transformed materials were cultured at 28°C for 16 hours under light conditions, and then continued to grow at 26°C for 48 hours in the dark, the anther chemical detection of GUS activity was carried out according to Jefferson's method. Soak the callus in the prepared X-Gluc solution and keep it overnight at 37°C. The next day, the callus is taken out and decolorized with 50%, 70%, and 100% alcohol in turn. After washing with sterilized distilled water, observe and take pictures. Such as image 3 As shown, the results showed that the anthers were stained blue in the transgenic pla...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


