Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof

A variety identification and molecular marker technology, applied in the field of molecular biology and genetics and breeding, can solve the problem that the molecular marker identification research of kiwifruit male series varieties has not been carried out, and achieve the effects of simple and intuitive morphological markers, poor polymorphism and easy operation.

Active Publication Date: 2017-11-24
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF5 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, research on molecular marker identification of ma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof
  • Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof
  • Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Acquisition of molecular marker primers for identification of kiwifruit Moshan series male varieties:

[0019] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). Mining the SSR sites of different repeating units in the whole genome, comparing the gene structure annotation results, and selecting the SSR sites in the gene interval to design amplification primers. Using the designed and synthesized primers, the kiwifruit ‘Moshan’ series varieties were amplified by PCR, and the molecular marker Geo15-115 was obtained by screening.

Embodiment 2

[0021] The application of molecular marker primers for the identification of kiwifruit Moshan series male varieties in the identification of kiwifruit Moshan varieties:

[0022] (1) According to the CTAB method, the DNA samples of 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshanxiong 4' and 'Moshanxiong 5' were extracted respectively .

[0023] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.

[0024] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.

[0025] (4) In the corresponding wells of the 96-well plate, 5 DNA samples from the Mo Shanxiong series were added, 50pg for each sample.

[0026] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a sealing film, shake, place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop. The PCR reaction was performed according to...

Embodiment 3

[0042] The application of molecular marker primers for the identification of kiwifruit male Moshan varieties in the identification of kiwifruit varieties:

[0043] Extract 'Moshanxiong No.1', 'Moshanxiong No.2', 'Moshanxiong No.3', 'Moshanxiong No.4', 'Moshanxiong No.5', 'Chuhong', 'Huaguang No.2' ', 'Xixuan No. 1' or 'Huayou' kiwifruit DNA samples, using the method of Example 2, using Geo15-115-F: CGAAGAAACAGGAAAGAGAATCG and Geo15-115-R: GGCACGGTGTACACCAGGAG. Molecular markers were identified for the above varieties.

[0044]Using the marker Geo15-115 to amplify the Moshan series varieties, it can specifically distinguish between 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshan 4', 'Moshanxiong Xiong 5', 'Chuhong', 'Huaguang 2', 'Xixuan 1' or 'Huayou' kiwifruit. The results showed that 'Moshanxiong 1' amplified 2 bands, which were 165bp and 169bp respectively; 'Moshanxiong 2' amplified 2 bands, which were 165bp and 179bp respectively; Two bands were amplified, wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding and specifically relates to molecular marker primers for identification of a Moshan series of male cultivars of kiwi fruits and an application thereof. The molecular marker primers provided by the invention are Geo15-115-F: CGAAGAAACAGGAAAGAGAATCG and Geo15-115-R: GGCACGGTGTACACCAGGAG. The primers can accurately distinguish and identify Moshan series of male cultivars of kiwi fruits and distinguish other species, have the universality of identification and are suitable for large-scale promotion.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and more specifically relates to molecular marker primers and application thereof for identification of kiwifruit Moshan series male varieties. Background technique [0002] In recent years, my country's kiwifruit industry has steadily expanded. As of 2016, the national cultivation area reached 2.2 million mu, with an output of 2.6 million tons and an output value of more than 20 billion yuan. Kiwifruit belongs to the dioecious type, that is, the pollen in the female flower is aborted, while the ovary is not fully developed and the ovule is aborted in the male flower. Therefore, in kiwifruit breeding and commercial orchard cultivation, it is usually necessary to select pollen from excellent male plants for cross-pollination to achieve kiwifruit fruiting. [0003] In recent years, the 'Moshan' male series of kiwifruit varieties selected and bred by the Wuhan Botanic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 张琼钟彩虹黄宏文韩飞
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap