Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof
A variety identification and molecular marker technology, applied in the field of molecular biology and genetics and breeding, can solve the problem that the molecular marker identification research of kiwifruit male series varieties has not been carried out, and achieve the effects of simple and intuitive morphological markers, poor polymorphism and easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Acquisition of molecular marker primers for identification of kiwifruit Moshan series male varieties:
[0019] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). Mining the SSR sites of different repeating units in the whole genome, comparing the gene structure annotation results, and selecting the SSR sites in the gene interval to design amplification primers. Using the designed and synthesized primers, the kiwifruit ‘Moshan’ series varieties were amplified by PCR, and the molecular marker Geo15-115 was obtained by screening.
Embodiment 2
[0021] The application of molecular marker primers for the identification of kiwifruit Moshan series male varieties in the identification of kiwifruit Moshan varieties:
[0022] (1) According to the CTAB method, the DNA samples of 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshanxiong 4' and 'Moshanxiong 5' were extracted respectively .
[0023] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.
[0024] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.
[0025] (4) In the corresponding wells of the 96-well plate, 5 DNA samples from the Mo Shanxiong series were added, 50pg for each sample.
[0026] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a sealing film, shake, place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop. The PCR reaction was performed according to...
Embodiment 3
[0042] The application of molecular marker primers for the identification of kiwifruit male Moshan varieties in the identification of kiwifruit varieties:
[0043] Extract 'Moshanxiong No.1', 'Moshanxiong No.2', 'Moshanxiong No.3', 'Moshanxiong No.4', 'Moshanxiong No.5', 'Chuhong', 'Huaguang No.2' ', 'Xixuan No. 1' or 'Huayou' kiwifruit DNA samples, using the method of Example 2, using Geo15-115-F: CGAAGAAACAGGAAAGAGAATCG and Geo15-115-R: GGCACGGTGTACACCAGGAG. Molecular markers were identified for the above varieties.
[0044]Using the marker Geo15-115 to amplify the Moshan series varieties, it can specifically distinguish between 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshan 4', 'Moshanxiong Xiong 5', 'Chuhong', 'Huaguang 2', 'Xixuan 1' or 'Huayou' kiwifruit. The results showed that 'Moshanxiong 1' amplified 2 bands, which were 165bp and 169bp respectively; 'Moshanxiong 2' amplified 2 bands, which were 165bp and 179bp respectively; Two bands were amplified, wh...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


