Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection primer, amplification system and detection kit of microsatellite instability site-BAT 26 site

An amplification system and unstable technology, applied in the field of biomedicine, can solve the problems of small number of detection cases and lack of large-scale clinical verification, and achieve the effect of simplifying the operation procedure and reducing the cost.

Active Publication Date: 2017-12-15
THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The BAT26 site is one of the important sites for the detection of microsatellite instability, but there are few studies on its detection by the HRM method, and only one report (Ramunas Janavicius, 2010) tried to use the HRM method to detect colorectal cancer specimens The detection of BAT25 and BAT26 loci in China, but the number of detection cases is not many, and there is a lack of clinical verification of large samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer, amplification system and detection kit of microsatellite instability site-BAT 26 site
  • Detection primer, amplification system and detection kit of microsatellite instability site-BAT 26 site
  • Detection primer, amplification system and detection kit of microsatellite instability site-BAT 26 site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1. Detection method of microsatellite instability site-BAT26 site

[0026] 1. Use Blend Taq Plus enzyme (Toyobo, CAT NO.BTQ-201) to configure the following reaction system

[0027] components

Dosage (μL)

10×Buffer

2.5

dNTP

2.5

EvaGreen

1.25

SEQ ID NO:1 Primer

1.25

SEQ ID NO:2 Primer

1.25

Taq enzyme

0.25

Enzyme-free water

15

[0028] 2. Adjust the DNA template concentration of tumor tissues and normal tissues of colorectal cancer patients to 50-100ng / ul. Add 1 ul of DNA template to the above system respectively.

[0029] The source of the tumor tissue of the above-mentioned patients with colorectal cancer: Paraffin sections prepared from surgically resected tumor specimens in the Sixth Affiliated Hospital of Sun Yat-sen University.

[0030] The source of normal tissue in patients with colorectal cancer: Paraffin sections prepared from surgically resected distal normal tiss...

Embodiment 2

[0033] Embodiment 2. Comparison of the results of different primer pairs

[0034] During the experiment, the inventor explored the influence of multiple sets of primer combinations on the experimental results. The experiments proved that the combination of primers determines the feasibility of the method. The following are the experimental results obtained by using multiple sets of exemplary primers in the method of Example 1 (Table 1).

[0035] Table 1. Comparison of 6 pairs of primer combinations used in the exploration process and their peak shapes and interpretation results

[0036]

[0037] Note: In this HRM detection method, the PCR program has a total of 40 cycles. The CT value of the sample amplification is preferably 18-25. If the CT value of the sample amplification is not within this range, it is interpreted that the PCR reaction cannot be amplified or the amplification effect is not good, and the amount of the amplified product may be affected in the end. and...

Embodiment 3

[0040] Example 3. Comparison of detection results between the method of the present invention and the fragment analysis kit.

[0041] Samples: 100 pairs (i.e., tumor tissue and its corresponding normal tissue) of colorectal cancer patient specimens obtained from the Department of Pathology, The Sixth Affiliated Hospital of Sun Yat-sen University.

[0042] The method of the present invention: the steps are as in Example 1, and the primers used are: F:TGCAGCAGTCAGAGCCCTTAR:GCTTTCTTCAGTATATGTCAATGAAAACA (SEQ ID NO: 1, SEQ ID NO: 2).

[0043]Fragment analysis method: Promega MSI Analysis System (CAT NO.MD1641) kit was selected, which is based on multiplex fluorescent PCR to detect microsatellite instability (MSI) in human cells. The detection method is: extract DNA from normal tissue and tumor tissue respectively, respectively amplify five microsatellite instability sites (BAT25, BAT26, NR21, NR24, MONO27), compare the capillary of microsatellite sites produced by the two Electro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological medicine, and relates to a detection primer, amplification system and detection kit of a microsatellite instability site-BAT 26 site. The sequence of the primer is shown as SEQ ID NO:1 and SEQ ID NO:2. The primer is adopted to perform high-resolution melting curve method and HRM detection, and is high in sensitivity and specificity.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to an amplification system and a detection kit for detecting the stability of microsatellites in tumor cells. Background technique [0002] Colorectal cancer (CRC) is a common malignant tumor with the fourth highest incidence rate among malignant tumor diseases worldwide, and the second highest mortality rate, which seriously threatens human health and life. Many characteristics exhibited in the pathogenesis of colorectal cancer are related to certain genetic changes. In order to enable more patients with colon cancer to receive more scientific and reasonable treatment, it is necessary to explore related genetic indicators to judge the prognosis of patients and the efficacy of chemotherapy, and to guide the treatment of patients. Individualized therapy has always been a revered theme. In recent years, clinical and basic research on microsatellite instability (MSI) has made good progress, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/6858C12Q2563/107C12Q2527/107C12Q2531/113
Inventor 傅新晖黄京林陈志婷林汉杰王婧璇王磊汪建平
Owner THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com