Detection primer, amplification system and detection kit of microsatellite instability site-BAT 26 site
An amplification system and unstable technology, applied in the field of biomedicine, can solve the problems of small number of detection cases and lack of large-scale clinical verification, and achieve the effect of simplifying the operation procedure and reducing the cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1. Detection method of microsatellite instability site-BAT26 site
[0026] 1. Use Blend Taq Plus enzyme (Toyobo, CAT NO.BTQ-201) to configure the following reaction system
[0027] components
Dosage (μL)
10×Buffer
2.5
dNTP
2.5
EvaGreen
1.25
SEQ ID NO:1 Primer
1.25
SEQ ID NO:2 Primer
1.25
Taq enzyme
0.25
15
[0028] 2. Adjust the DNA template concentration of tumor tissues and normal tissues of colorectal cancer patients to 50-100ng / ul. Add 1 ul of DNA template to the above system respectively.
[0029] The source of the tumor tissue of the above-mentioned patients with colorectal cancer: Paraffin sections prepared from surgically resected tumor specimens in the Sixth Affiliated Hospital of Sun Yat-sen University.
[0030] The source of normal tissue in patients with colorectal cancer: Paraffin sections prepared from surgically resected distal normal tiss...
Embodiment 2
[0033] Embodiment 2. Comparison of the results of different primer pairs
[0034] During the experiment, the inventor explored the influence of multiple sets of primer combinations on the experimental results. The experiments proved that the combination of primers determines the feasibility of the method. The following are the experimental results obtained by using multiple sets of exemplary primers in the method of Example 1 (Table 1).
[0035] Table 1. Comparison of 6 pairs of primer combinations used in the exploration process and their peak shapes and interpretation results
[0036]
[0037] Note: In this HRM detection method, the PCR program has a total of 40 cycles. The CT value of the sample amplification is preferably 18-25. If the CT value of the sample amplification is not within this range, it is interpreted that the PCR reaction cannot be amplified or the amplification effect is not good, and the amount of the amplified product may be affected in the end. and...
Embodiment 3
[0040] Example 3. Comparison of detection results between the method of the present invention and the fragment analysis kit.
[0041] Samples: 100 pairs (i.e., tumor tissue and its corresponding normal tissue) of colorectal cancer patient specimens obtained from the Department of Pathology, The Sixth Affiliated Hospital of Sun Yat-sen University.
[0042] The method of the present invention: the steps are as in Example 1, and the primers used are: F:TGCAGCAGTCAGAGCCCTTAR:GCTTTCTTCAGTATATGTCAATGAAAACA (SEQ ID NO: 1, SEQ ID NO: 2).
[0043]Fragment analysis method: Promega MSI Analysis System (CAT NO.MD1641) kit was selected, which is based on multiplex fluorescent PCR to detect microsatellite instability (MSI) in human cells. The detection method is: extract DNA from normal tissue and tumor tissue respectively, respectively amplify five microsatellite instability sites (BAT25, BAT26, NR21, NR24, MONO27), compare the capillary of microsatellite sites produced by the two Electro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


