Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentiviral vector containing CPEB1 gene negative regulation region as well as preparation method and applications of lentiviral vector

A technology of lentiviral vector and negative regulation, which is applied in the field of lentiviral vector and its preparation, can solve the problems of unclear microRNA-122 and its target gene CPEB1, and achieve high transcription efficiency and high infection efficiency

Inactive Publication Date: 2018-01-09
SHENZHEN INST OF ADVANCED TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] By studying the microRNA profile related to immune rejection after corneal transplantation, the inventor's research group found that corneal immune rejection is related to miR-122 and its target gene CPEB1, but how does microRNA-122 and its target gene CPEB1 play a role in corneal transplant rejection? The role is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector containing CPEB1 gene negative regulation region as well as preparation method and applications of lentiviral vector
  • Lentiviral vector containing CPEB1 gene negative regulation region as well as preparation method and applications of lentiviral vector
  • Lentiviral vector containing CPEB1 gene negative regulation region as well as preparation method and applications of lentiviral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] A method for constructing a lentiviral vector comprising a negative regulatory region of the CPEB1 gene, comprising the following steps:

[0031] 1) Amplify the coding sequence of CPEB1 gene from mouse dendritic cells

[0032] According to the gene sequence of CPEB1 on NCBI (NM_030594), primers for its coding sequence were designed:

[0033]Upstream primer (SEQUENCE ID NO:2):

[0034] CTCCCAAGCTTATCGATA GTCCCTTAGGGCCACGC, the underlined part was cloned into the ClaI restriction site of pLVX-IRES-ZsGreen1 by In-Fusion recombination method (Takara).

[0035] Downstream primer (SEQUENCE ID NO:3):

[0036] CTAA GCGATCGC TCAGTTCTTCTGGTTCCTCATTAGG, the underlined part is the SgfI restriction site, which is used to connect with its 3'-UTR fragment. The fragment was amplified by PCR, and the theoretical size was 1760bp. figure 1 For the results of agarose gel electrophoresis detection of CPEB1 amplification products, such as figure 1 It is shown that there is an obviou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lentiviral vector containing a CPEB1 gene negative regulation region as well as a preparation method and applications of the lentiviral vector. The lentiviral vector containing the CPEB1 gene negative regulation region or a recombinant lentivirus has very high infection efficiency and transcription efficiency, an inserted coding gene can be inserted into a host genome through gene recombination, and thus a host cell can continuously and stably express CPEB1. A very simple and convenient tool is provided for researching the effects of microRNA-122 and a target gene CPEB1 of microRNA-122 in cornea graft rejection.

Description

technical field [0001] The invention relates to the field of biomedical materials, in particular to a lentiviral vector containing a negative regulatory region of CPEB1 gene and its preparation method and application. Background technique [0002] Cytoplasmic polyadenylation elementbinding protein (CPEB) is an mRNA-binding protein that plays important biological functions in both invertebrates and vertebrates. Studies have shown that the large expression of CPEB1 is closely related to the immune rejection of corneal transplantation, and CPEB1 regulates the gene expression of various tissues and organs, and is related to the occurrence and development of various diseases. [0003] By studying the microRNA profile related to immune rejection after corneal transplantation, the inventor's research group found that corneal immune rejection is related to miR-122 and its target gene CPEB1, but how does microRNA-122 and its target gene CPEB1 play a role in corneal transplant rejecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N5/10
Inventor 阮庆国王绍文李凤洁万晓春
Owner SHENZHEN INST OF ADVANCED TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com