Method for controlling expression ratio of different genes through prokaryotic cell post-transcriptional level

A level control and gene expression technology, applied in the field of gene expression regulation and genetic engineering, can solve the problems of inability to finely regulate the level of gene expression, increase the complexity of the reaction process, increase the production cost, etc.

Active Publication Date: 2018-03-27
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are many problems in practical application: firstly, the reaction system needs to add a variety of inducers, and when there are many links in the design of the metabolic pathway, expensive substances will inevitably be used, which greatly increases the production cost; secondly, relatively The addition of multiple inducers will increase the complexity of the reaction process, thereby reducing cell stability; third, the addition of multiple inducers may cause interaction, which limits the application of multiple promoter combinations; fourth, only Rough expression regulation of gene expression, that is, turning on or off, but not fine regulation of gene expression level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for controlling expression ratio of different genes through prokaryotic cell post-transcriptional level
  • Method for controlling expression ratio of different genes through prokaryotic cell post-transcriptional level
  • Method for controlling expression ratio of different genes through prokaryotic cell post-transcriptional level

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 - Construction of a reporter system for dual fluorescent proteins

[0042] 1) Cell culture

[0043] The bacterial strains and plasmids involved in the following are listed in Table 1. Escherichia coli DH5α was cultured at 37 degrees in common LB medium. The main purpose of its culture is to facilitate the construction and replication of plasmids, so that more plasmids can be used in the transformation of Clostridium cellulolyticum.

[0044] Then, the plasmids in Table 1 were introduced into Escherichia coli by conventional means, and the Escherichia coli containing the plasmids were respectively cultured in LB medium added with 100 μg / ml ampicillin until the mid-late logarithmic period.

[0045] Clostridium cellulolyticus is a strictly anaerobic cellulose-degrading bacterium. The cells are cultured in a Hengate roller tube at a constant temperature of 35 degrees. The culture medium is DCB-1, and 0.0005% resazurin is used as oxygen. indicator.

[0046] Then, ...

Embodiment 2

[0057] Embodiment 2——Determination of endoribonuclease recognition cleavage site

[0058] 1) Design a neck loop structure containing endoribonuclease recognition cleavage sites

[0059] The neck ring structure is a neck ring structure containing AT-rich region and bubbling. Its gene sequence is: TATTTAATACTATGACGCATATGTAACCTTAAAGTCCGGACAGTATTTGGTTTGATTAAATTACTCATTCTTGTACTGTCCGGGCTTATGAGTTACAAAGAAAAAAAGAAAAGGATTAAGGTAAGAAC, named WT. Through different degrees of truncation mutations, they were named as T22, T28, T56, T88, and T98, and a series of sequences were synthesized that deleted the AT-rich region, bubbling region, and neck loop structure at the 5' end. The base A at the 3' end of the unpaired bubbling region was deleted to construct a point mutation neck loop structure P88. The base A at the 3' end and the base C at the 5' end of the unpaired bubbling region were simultaneously deleted to construct a point mutation neck loop structure D28&88 (such as Figure 2A shown)...

Embodiment 3

[0062] Example 3—Neck ring structure and function identification

[0063] 1) Real-time quantitative PCR analysis of the effects of different sequences on the transcription of fbfp and mCherry

[0064] From the RNA extracted respectively from a series of Clostridium cellulolyticum transformants obtained in Example 2, and after reverse transcription of cDNA, the RNA polymerase subunit (Ccel_0312) was used as an internal reference gene by 480II (Roche) was used for fluorescent quantitative PCR to compare the transcription levels of fbfp, mCherry, and the spacer IR between them in different transformants (such as image 3 ).

[0065] qRT-PCR results showed that in the dual fluorescent protein reporter system (Control) without adding any sequence, the transcript abundances of fbfp, mCherry, and the spacer IR between them were basically the same, indicating that fbfp and mCherry belonged to the same transcript unit. But when the designed complete sequence (WT) was introduced be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene expression regulation and gene engineering, particularly to a method for controlling the expression ratio of different genes through a prokaryotic cell post-transcriptional level. According to the present invention, based on the structure of the prokaryotic gene operator, the endoribonuclease-specific cleavage site and the sequence of the stem-loop structure are introduced by the exogenous plasmid to control the stabilities of different fragments so as to control the transcription level of the genes encoded by the fragments; and with the method, the controllable expressions of different genes according to the specific ratio in vivo can be achieved, and the effective synthetic biology method is provided for the successful construction of the multi-subunit complex containing the specific ratio and the multiple enzyme synergistic metabolic pathway engineering stain.

Description

technical field [0001] The invention relates to the fields of gene expression regulation and genetic engineering, in particular to a method for controlling the expression ratio of different genes at the post-transcription level of prokaryotic cells. Background technique [0002] With the completion of more and more whole-genome sequencing of microorganisms and the systematic understanding of microbial metabolic networks, multiple genes or even a complete set of metabolic pathways can be introduced into cells through synthetic biology methods, and constructs containing multiple exogenous genes microbial cell factory. This method has been applied in the production of various substances, such as terpenoids, polyketides, bioplastics, non-ribosomal polypeptides, etc. The construction of new metabolic pathways can not only omit the purification work of chemical synthesis intermediates, but also realize the synthesis of biofuels, chemical intermediates of natural complex products ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N15/113C12R1/145
CPCC12N15/113C12N15/74C12N2310/10C12N2310/531
Inventor许成钢王艺霖滕琳徐健
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI