Check patentability & draft patents in minutes with Patsnap Eureka AI!

Leptobotia elongate DNA barcode sequence and application thereof

A long-thin loach, barcode technology, applied in the application, biochemical equipment and methods, botanical equipment and methods, etc., can solve the problems of no records and reports, etc.

Inactive Publication Date: 2018-05-04
JIANGHAN UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In the existing technical centers, there is no record and report of the standard detection sequence of the long thin loach DNA barcode and the long thin loach COI gene as the standard detection sequence of the long thin loach DNA barcode

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Take one tail of Zhuyangxi longboloach and the DNA barcode sequence of longboly loach of the present invention for verification.

[0018] 1. Extraction of DNA

[0019] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0020] 2. PCR amplification

[0021] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0022] Table 1 PCR reaction system

[0023] reactive component

Volume (μl)

Sterilized double disti...

Embodiment 2

[0033] Take 1 tail of Yibin long thin loach and verify the DNA barcode sequence of long thin loach of the present invention.

[0034] 1. Extraction of DNA

[0035] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0036] 2. PCR amplification

[0037] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0038] 3. Agarose gel electrophoresis detection

[0039] Perform electrophoresis on the PCR product at a constant voltage of 5 V / ...

Embodiment 3

[0045] One tail of Minjiang longboloach was taken and the DNA barcode sequence of longbottomy loach of the present invention was verified.

[0046] 1. Extraction of DNA

[0047] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0048] 2. PCR amplification

[0049] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0050] 3. Agarose gel electrophoresis detection

[0051] Perform electrophoresis on the PCR product at a constant v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a leptobotia elongate DNA barcode sequence and an application thereof and belongs to the technical field of species identification. The leptobotia elongate DNA barcodes refer to leptobotia elongate COI genes, the DNA barcode sequence can serve as a standard detection sequence of leptobotia elongate DNA, and endemic species of the leptobotia elongate can be effectively identified.

Description

technical field [0001] The invention belongs to the technical field of species identification, and in particular relates to a long thin loach DNA barcode sequence and application thereof. Background technique [0002] Species identification has always been a crucial foundational step in the study of taxonomy and indeed almost all biological fields. Therefore, accurate identification of species, especially for those rare species and species with protection significance, classification and identification work is particularly important. [0003] Long thin loach (Leptobotia elongata), belonging to Cobitidae (Cobitidae) subfamily (Botiinae) and Leptobotia (Leptobotia), is a unique fish in the upper reaches of the Yangtze River, mainly distributed in the middle and upper reaches of the Yangtze River and its tributaries. Long thin loach is the fastest growing and largest individual among the Loach family fishes. Its body color is bright and its meat is delicious. It is a famous ec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/53
CPCC12Q1/6888
Inventor 刘红艳熊飞王莹
Owner JIANGHAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More