Leptobotia elongate DNA barcode sequence and application thereof
A long-thin loach, barcode technology, applied in the application, biochemical equipment and methods, botanical equipment and methods, etc., can solve the problems of no records and reports, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0017] Take one tail of Zhuyangxi longboloach and the DNA barcode sequence of longboly loach of the present invention for verification.
[0018] 1. Extraction of DNA
[0019] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0020] 2. PCR amplification
[0021] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0022] Table 1 PCR reaction system
[0023] reactive component
Volume (μl)
Sterilized double disti...
Embodiment 2
[0033] Take 1 tail of Yibin long thin loach and verify the DNA barcode sequence of long thin loach of the present invention.
[0034] 1. Extraction of DNA
[0035] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0036] 2. PCR amplification
[0037] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0038] 3. Agarose gel electrophoresis detection
[0039] Perform electrophoresis on the PCR product at a constant voltage of 5 V / ...
Embodiment 3
[0045] One tail of Minjiang longboloach was taken and the DNA barcode sequence of longbottomy loach of the present invention was verified.
[0046] 1. Extraction of DNA
[0047] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0048] 2. PCR amplification
[0049] The general primers of COI gene in carps were used as PCR primers. The sequences of the upstream and downstream primers were: FCOI: TCAACCAACCACAAAGACATTGGCAC, RCOI: TAGACTTCTGGGTGGCCAAAGAATCA. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0050] 3. Agarose gel electrophoresis detection
[0051] Perform electrophoresis on the PCR product at a constant v...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com