Unlock instant, AI-driven research and patent intelligence for your innovation.

Sequence capable of serving as depression marker

A depression and sequence technology, applied in the biological field, can solve problems such as the unclear pathogenesis and treatment principles of depression, and the inability to fully explain the cause of depression

Inactive Publication Date: 2018-06-12
广州市番禺区中心医院
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The pathogenesis and treatment principles of depression are still unclear. In the past, it was believed that genetic factors, biological factors, and psychosocial factors had a certain impact on the occurrence of depression. Neuroelectrophysiological and neuroimaging studies have put forward a variety of etiological hypotheses, possible related endocrine axes, changes in brain structure and function, changes in brain circuits and signaling pathways, and have made corresponding progress. , but still can not fully explain the pathogenesis of depression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence capable of serving as depression marker
  • Sequence capable of serving as depression marker

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0018] Experimental example 1 material and processing:

[0019] collection of samples

[0020] Take 1ml of fresh anticoagulated blood, mix it with whole blood and tissue homogenate diluent 1:1, carefully add to the liquid surface of 2ml of cell separation medium, and centrifuge at 1500-2000 rpm (horizontal rotor with a radius of 15cm) ) for 15 minutes, the cells in the centrifuge tube were divided into four layers from top to bottom. The first layer; the plasma layer. The second layer; ring milky white lymphocytes. The third layer; is a transparent separation liquid layer. The fourth layer is the red blood cell layer. Collect the second layer of cells and put them into a test tube containing 4-5 ml of cell washing solution. After mixing thoroughly, centrifuge at 1500-2000 rpm for 10-30 minutes. The pellet was washed twice repeatedly to obtain the desired cells.

[0021] 2) Sample preparation and evaluation

[0022] RNA sample preparation

[0023] Take 2ml samples from e...

experiment example 2

[0031] Experimental Example 2 Real-time fluorescent quantitative PCR detection

[0032] Primer design

[0033] The verified TFCP2L1 was randomly selected for fluorescence quantitative verification. to 2 -ΔΔCt The fold difference was calculated by the method and detected by RT-PCR. The PCR primer sequences are as follows:

[0034] Table 1 RT-PCR primer list

[0035]

[0036]

[0037] Detect the sequence of the gene, the gene sequence is:

[0038] TCCGGCTTCTTCGTCTTCAGCCGCCTGGAGGTGACCAGGGCCGAATGGGAGCAGAAAGATGAGTTCATCTGCCGTGCAGTCCATGAGGCAGCGAGCCCCTCACAGACCGTCCAGCGAGCGGTGTCTGTAA ATCCCG (SEQ ID NO: 5)

[0039] RT-PCR for verification

[0040] RT-PCR was used for verification. To establish an 8 μL system, add 5 μL of 2×Master Mix, 0.5 μL of forward and reverse primers, and 2 μL of distilled water. Add 8 μL of the mixture to each corresponding well of the 384-PCR plate, add the corresponding 2 μL of cDNA, carefully stick the Sealing Film on it, and briefly centrifuge to ...

experiment example 3R

[0041] Experimental example 3 RT-PCR detection result analysis

[0042]The data of 105 cases of depression in Panyu Central Hospital (54 males, 51 females) and 132 normal people (69 males, 63 females) were selected for analysis. The results are as follows

[0043] Table 2 △Ct value of patients with depression and normal population

[0044]

[0045] The results showed that, compared with the normal population, the expression level of the gene in the depressed population was significantly reduced. Therefore, detecting the expression of the gene can be used as a marker for auxiliary diagnosis of depression.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene for low expression in depression, and further discloses a primer sequence for detecting the gene. The gene has obvious expression difference between depressed people andnon-depressed people, and a clinical auxiliary diagnosis technology for depression is not perfect yet at present, so that the gene has the potential of serving as a depression-related biomarker.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a new marker for depression. Background technique [0002] The core symptoms of depression are low mood, loss of interest, and lack of energy. More than 350 million people worldwide suffer from depression. The World Health Organization predicts that by 2020, depression will occupy the second place in the world's disease burden. [0003] Depression poses a significant burden to society. The reasons are high incidence, younger onset, chronic development, impairment of social function and cognitive ability, and unnatural death. The proportion of suicide deaths and suicide attempts in patients with depression is much higher than that of suicide attempts. much higher than in the general population. Therefore, research on the pathogenesis of depression and biomarkers that can reflect its severity, and timely intervention and treatment of the cause are the key factors for treating the dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/12
CPCC12Q1/6883C12Q2600/118C12Q2600/158
Inventor 朱海兵
Owner 广州市番禺区中心医院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com