General expression framework of artificial circular RNA and application thereof
An artificial and circular technology, applied in the direction of retroRNA viruses, DNA/RNA fragments, applications, etc., can solve the problems of difficult realization of circRNA chemical synthesis technology, single tumor microRNA network regulation ability, and insufficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Construction of Artificial Circular RNA Overexpression Framework Sequence and Scramble Negative Control Sequence Lentiviral Vector
[0058] 1. Design and synthesis of primers
[0059] Primer design with Primer5 software:
[0060] Circ-F: TTAGGCGCGCCTGAGATTACAGGTGTGAGCC
[0061] Circ-R: GCTTTGTTTAAACGGGATTACAGGTGTGAGCTAC
[0062] The primer sequences were synthesized by Shanghai Huada Gene Company.
[0063] 2. PCR amplification of artificial circular RNA overexpression framework sequence and scramble negative control sequence
[0064] Using the artificial circular RNA overexpression framework sequence or scramble negative control sequence DNA obtained by whole gene synthesis as a template, PCR amplifies the target fragment. The amplification system is as follows:
[0065] 10×Buffer
10ul
MgSO 4 (50mM)
1ul
dNTP (10mM)
1.5ul
transStart Fastpfu DNA polymerase (5U / ul)
0.5ul
Circ-F (10uM)
2ul
Circ-R (1...
Embodiment 2
[0097] Example 2: qPCR detection of overexpression effect of artificial circular RNA and scramble negative control circRNA in 293T cells after lentiviral plasmid transfection
[0098] 1. Colon-circ-1qPCR primer design:
[0099] divergent primer-F1: as shown in SEQ ID NO.7.
[0100] divergent primer-R: as shown in SEQ ID NO.8.
[0101] colon-circ-scramble NC-1qPCR primer design:
[0102] divergent primer-F2: as shown in SEQ ID NO.9.
[0103] divergent primer-R: as shown in SEQ ID NO.10.
[0104] Colon-circ-2qPCR primer design:
[0105] divergent primer-F3: as shown in SEQ ID NO.11.
[0106] divergent primer-R: as shown in SEQ ID NO.12.
[0107] colon-circ-scramble NC-2qPCR primer design:
[0108] divergent primer-F4: as shown in SEQ ID NO.13.
[0109] divergent primer-R: as shown in SEQ ID NO.14.
[0110] The above primer sequences were synthesized by Shanghai Huada Gene Company.
[0111] 2. 24 hours before transfection, digest 293T cells in the logarithmic growth pha...
Embodiment 3
[0149] Example 3: Artificial circular RNA and scramble negative control circRNA and negative control lentivirus (empty virus) packaging
[0150] 1. 24 hours before transfection, digest 293T cells in the logarithmic growth phase with trypsin, transfer to 10cm cell culture dish, 37°C, 5% CO 2 Cultured in an incubator. After 24 hours, when the cell density reaches 70%-80%, it can be used for transfection. Cell state is critical for virus packaging, so good cell state and low passage times need to be guaranteed.
[0151] 2. Replace the cell culture medium with serum-free medium before transfection.
[0152] 3. Add the prepared plasmid DNA solutions (lentiviral plasmid 10 μg, helper plasmids pLP1, pLP2, pLP / VSVG each 5 μg) into a sterilized centrifuge tube, mix with the corresponding volume of Opti-MEM, and adjust the total volume to 1.5ml.
[0153] 4. Shake the Lipofectamine 2000 reagent gently, take 60 μl Lipofectamine 2000 reagent and mix it with 1.5ml Opti-MEM in another tu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


