Recovery method of defect type of URA3 (Uracil 3) gene of polyploid industrial saccharomyces cerevisiae strain
A technology of brewer's yeast and genetic defects, applied in the field of brewer's yeast genetic engineering, can solve the problems of engineering bacteria's growth performance and fermentation performance, and achieve the effect of realizing genetic manipulation and high safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] The specific operation flow chart is as follows figure 1 shown, including the following steps:
[0057] Preparation of URA3 gene-deficient strain:
[0058] The URA3 gene-deficient strain is obtained by replacing the URA3 gene in the industrial brewer's yeast strain S17 with the mutated URA3 gene in the mutant strain W303-1A. First, the genome of the mutant strain W303-1A was used as a template, and δURA3-F and δURA3-R were used as primers; the sequence of δURA3-F was GTTCATCATCTCATGGATCTGC; the sequence of δURA3-R was: TTCAGTTTTGGATAGATCAGTTAGAGATTTATCTTCGTTTCCTGC. Perform PCR amplification to obtain the mutated URA3 gene; see Table 1 for the specific PCR amplification system and procedure.
[0059] Table 1 The system and procedure of PCR amplification of mutated URA3 gene
[0060]
[0061]
[0062] PCR reaction program
[0063]
[0064] T a : The annealing temperature is determined according to the GC content of the primer, T=22+1.46(2(G+C)+(A+T));
[00...
Embodiment 2
[0087] Reversion method of URA3 gene-deficient strain
[0088] 1. The strain overexpressing the URA3 gene is the preparation of S17-u+U:
[0089] The PGK1p, URA3 and URA3t gene fragments are connected to obtain a high expression component of the URA3 gene. In the present invention, the primer sequences for amplifying the strong promoter of PGK1p are preferably shown in SEQ ID NO.3 and SEQ ID NO.4; specifically, AACCTGCAGGAAACGAAGATAAATCTCTAACTGATCTATCCAAAA and TCCTTATATGTAGCTTTCGACATGTTTTATATTTGTTGTAAAAAG; the primer sequences for amplifying the URA3 gene in the present invention Such as SEQ ID NO. 5: GCTTCAATAAAACTCAAGTGATTTTAGAACTCATTTCATCCATATTAAC and SEQ ID NO. 6: CAGTTTTGGATAGATCAGTTAGAGGTTAGATTAGATATGGTTTCTC. The primer sequences for amplifying the URA3t gene in the present invention are shown in SEQ ID NO. 7: ACTTTTTACAACAAATATAAAACATGTCGAAAGCTACATATAAGG and SEQ ID NO. 8: CGGCCCAAGCCTTGTCCCAAGG. In the present invention, the PCR amplification system and procedure of t...
Embodiment 3
[0099] Verification of growth performance and fermentation performance of S17’1 and S17’2
[0100] Growth Performance Verification:
[0101] In this experiment, an automatic growth curve analyzer was used to measure the OD600 absorbance value, and the operation steps were as follows:
[0102] (1) Take an appropriate amount of slant bacteria and put it into 5mL YEPD medium, and culture it at 30°C and 180rpm for 12h.
[0103] (2) Take 40 μL of the above-mentioned bacterial solution and insert it into the well of a 100-well plate with 360 μL of liquid YEPD medium, place it for culture at 30 ° C, take YEPD liquid medium as a blank control, measure the absorbance at 600 nm every 0.5 h, and use The time is the abscissa, the OD value is the ordinate, and the growth curve is drawn. Growth curve such as Figure 4 As shown, a is the growth curve of the two transformants and the original strain that have not yet been subjected to the strain acclimation experiment of directly restoring...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More