Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of quality detection method of Dendrobium nobile

A quality inspection method and technology of Dendrobium candidum, applied in measurement devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, effectively identify and control quality, and solve problems. Effects of the curse of dimensionality

Active Publication Date: 2021-03-16
北京蓝标一成科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of quality detection method of Dendrobium nobile
  • A kind of quality detection method of Dendrobium nobile
  • A kind of quality detection method of Dendrobium nobile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Generation Sequencing of Dendrobium chinensis

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5' GAATTCCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5'ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] Amplification and sequencing parameters were: 98°C for 2 min, followed by PCR cycle, the PCR cycle parameters were 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C for incubation after amplification, and proceed Next-Generation Molecular Sequencing.

[0057] Through next-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium chinensis.

Embodiment 2

[0058] Embodiment 2 The extraction method of Dendrobium chinensis

[0059] Take a dry sample of Dendrobium dendrobium, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (pore size 0.335mm), accurately weigh 1.000g of Dendrobium dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, add 50mL 75 % methanol (V water:V methanol=25:75), take out after sonicating for 30min at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve with 75% methanol solvent (V water:V methanol=25:75), and finally transfer Dilute to a volume of 10ml in a volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium dendrobium.

Embodiment 3

[0060] Embodiment 3 The chromatographic detection method of Dendrobium chinensis extract

[0061] ①Preparation of reference solution

[0062] Precisely weigh 4.10 mg of schavertoside and 4.08 mg of naringenin, respectively, place them in a 10 ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, and shake well to serve as a stock solution. Store in a 4°C refrigerator for later use.

[0063] Then, a certain amount of the reference substance stock solution was precisely drawn, and diluted with 75% methanol to accurately prepare a mixed reference substance solution of schafftoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared ingredients are diluted. Inject into the high performance liquid chromatograph.

[0064] ②Determination of the content of small molecular components of Dendrobium chinensis Extraction and processing method:

[0065] Take 1.00g of this product powder (passed through a No. 3 sieve), accurately weigh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium nobile Lindley. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the varietyof a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium nobile Lindley; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. Accordingto the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium nobile Lindley is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine ingredients, and in particular relates to a quality detection method of Dendrobium chinensis. Background technique [0002] Dendrobium nobile Lindley: Stem erect, fleshy and hypertrophic, slightly flattened cylindrical, 10cm-40cm long, up to 1.3cm in diameter, the upper part is more or less folded, the base is obviously narrowed, unbranched, with many nodes , The nodes are sometimes slightly enlarged; the internodes are more or less conical, 2cm-4cm long, and golden yellow when dry. Leaf base with clasping sheaths. Racemes are often issued from above the middle of leafy or deciduous old stems, 2cm to 4cm long, with 1 to 4 flowers; inflorescence peduncle is 0.5cm to 1.5cm long, with several tubular sheaths at the base; bracts membranous , ovate-lanceolate, 0.6cm-1.3cm long, apex acuminate; pedicel and ovary lavender, 0.3cm-0.6cm long; flowers large, white with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N30/02G01N30/06
CPCG01N30/02G01N30/06
Inventor 赵田刘仲健
Owner 北京蓝标一成科技有限公司