Unlock instant, AI-driven research and patent intelligence for your innovation.

Quality detection method of Dendrobium fimbriatum Hook

A quality inspection method and technology of Dendrobium tassel, applied in measurement devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, achieve correlation analysis, effective identification and The effect of quality control

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF13 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium fimbriatum Hook
  • Quality detection method of Dendrobium fimbriatum Hook
  • Quality detection method of Dendrobium fimbriatum Hook

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Generation sequencing of Dendrobium fringe

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0057] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium fringe.

Embodiment 2

[0058] The extraction method of embodiment 2 Dendrobium fringe

[0059] Take the dried sample of Dendrobium fringe, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml Erlenmeyer flask, add 50mL of 75% Methanol (V water: V methanol = 25:75), after ultrasonication for 30 minutes at room temperature, it was taken out, filtered, the filtrate was concentrated to dryness by rotary evaporation, dissolved in 75% methanol solvent (V water: V methanol = 25:75), and finally transferred to Dilute to volume in a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium fringe.

Embodiment 3

[0060] Example 3 The chromatographic detection method of Dendrobium fringe extract

[0061] ①Preparation of reference solution

[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for determination of small molecular components of Dendrobium fringe:

[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volumetric flask, add ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium fimbriatum Hook. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium fimbriatum Hook; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components in thefingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium fimbriatum Hook is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine components, and in particular relates to a quality detection method of dendrobium fringe. Background technique [0002] Dendrobium fimbriatum (scientific name: Dendrobium fimbriatum Hook.): thick stem, erect or drooping, hard texture, cylindrical or sometimes slightly spindle-shaped above the base, 50cm-85cm long, 0.8cm-1.5cm in diameter, unbranched, with Multi-noded, light yellow or light yellow-brown after drying, internodes 3.5cm-4.8cm long, with many longitudinal grooves; leaf bases have leathery sheaths tightly hugging stems. Racemes 5cm-15cm long, 6-12 flowers sparsely; inflorescence rachis slender, somewhat curved; inflorescence peduncle 2cm-4cm long, base covered by several sheaths; sheath leathery, tubular, located at base The shortest, about 0.3cm long, the longest at the top, up to 1cm; bracts are membranous, ovate-triangular, 0.3cm-0.5cm long, with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N30/86
CPCG01N30/86
Inventor 赵田张国强
Owner 北京蓝标一成科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More