Method for producing gamma-aminobutyric acid with high yield

A technology of amino acid and glutamic acid, which is applied in the field of bioengineering, can solve the complicated problems of separation and purification of GABA, meet the needs of industrialization, wide pH stability range, and reduce production costs

Active Publication Date: 2018-08-31
JIANGNAN UNIV +1
View PDF19 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The fermentation broth obtained by the traditional direct fermentation method is a complex system, containing a large amount of impurities such as bacteria, protein, and inorganic salts, and the downstream separation and purification of GABA is complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing gamma-aminobutyric acid with high yield
  • Method for producing gamma-aminobutyric acid with high yield
  • Method for producing gamma-aminobutyric acid with high yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Acquisition of Bacillus megaterium glutamic acid decarboxylase gene

[0032] (1) Bacillus megaterium strains were inoculated in LB medium, cultured at 37°C for 12 hours to collect the bacterial cells, and genomic DNA was extracted using a bacterial genome extraction kit.

[0033] (2) Using primers gaD1 (5'GGGTTTCATATGATGCCTCAATGGCATCCGCATCG 3', the sequence is shown in SEQ ID NO:5) and gaD2 (5'CCGCTCGAGTTAATGATGAAATCCATTGTCGTAT 3', the sequence is shown in SEQ ID NO:6) to clone glutamic acid from genomic DNA gaD gene of decarboxylase;

[0034] (3) Connect the gene to the PMD19simple cloning vector for sequencing to obtain a gene sequence such as SEQ ID NO:1, and a corresponding amino acid sequence such as SEQ ID NO:3;

[0035] (4) Digest the target gene and expression vector pET24a at 37°C for 2 hours with restriction endonucleases Nde I and XhoI;

[0036] (5) Ligate the target gene and plasmid pET24a after digestion and gel recovery with T4 ligase at 16°C ...

Embodiment 2

[0038] Example 2: Protein engineering of Bacillus megaterium glutamate decarboxylase

[0039] (1) Using Modeller software to carry out homology modeling on glutamic acid decarboxylase GAD (JMB 342, 119-130 (2004)), the key amino acids F67, V68, M88, and I89 of the Loop structure of the catalytic active center of GAD were mutated to Alanine; after the mutation, construct a recombinant strain according to the method in Example 1, collect the thalline after shaking the flask for fermentation, and perform enzyme activity detection. The results are shown in Table 1. The 67th phenylalanine F and the 68th valine When the acid V was mutated into alanine A, the enzyme activity of GAD increased by 26.8% and 49.0%, respectively, indicating that the 67th and 68th positions were the key sites affecting the enzyme activity, so two sites were selected for combined mutation.

[0040] Table 1 Determination of enzyme activity of different mutants

[0041]

[0042] (2) Combining mutations of...

Embodiment 3

[0043] Embodiment 3: recombinant bacterial strain fermentation produces glutamic acid decarboxylase

[0044] (1) Seed medium formula: LB medium, yeast powder 5g / L, tryptone 10g / L, NaCl 10g / L.

[0045] Fermentation medium formula: glycerol 5g / L, yeast powder 20g / L, tryptone 15g / L, K 2 HPO 4 12H 2 O 3.0g / L, KH 2 PO 4 18.0g / L.

[0046] The composition of the feed medium is: glycerol 500g / L, MgSO 4 ·7H 2 O 30g / L.

[0047] (2) Recombinant strains E.coli BL21-GAD and E.coli BL21-GAD* were inoculated in the fermentation medium according to the inoculum size of 5%, the air volume was 0.8-1.5vvm, the temperature was 37°C, and the agitation was 600rpm to cultivate until the OD600 was 3.0-4.0 , lower the temperature to 25°C, add 5g / L lactose to induce the expression of glutamic acid decarboxylase, when the OD600 reaches 11.0-13.0, the dissolved oxygen suddenly rises, and the rate of 4-5mL / h per liter of fermentation broth starts to be supplemented Feed the medium, and finish the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing gamma-aminobutyric acid with a high yield, and belongs to the technical field of bioengineering. Glutamic acid decarboxylase derived from Bacillus megaterium is modified by protein engineering, and a modified glutamic acid decarboxylase gene is linked to a pET24a vector, and is epressed in E. coli BL21 (DE3). A recombinant strain is cultured in a fermenter for transforming glutamic acid to produce the gamma-aminobutyric acid, the wet cell addition amount is 7.0g / L, the transformation period is 8h, the yield can reach 425.0g / L, and the glutamic acid molar conversion rate is up to 99%, the space time yield of the gamma-aminobutyric acid is 53.1 g / L / h.

Description

technical field [0001] The invention relates to a method for high-yielding gamma-aminobutyric acid, which belongs to the technical field of bioengineering. Background technique [0002] γ-aminobutyric acid, also known as 4-aminobutanoic acid (GABA), widely exists in nature and is an important inhibitory neurotransmitter in the central nervous system of mammals. It has important physiological functions and has been reported Physiological activity has various effects such as regulating blood pressure, promoting mental stability, promoting brain blood flow, nourishing nerve cells, increasing growth hormone secretion, strengthening liver and kidney, preventing obesity, and improving menopausal syndrome. It is widely used in medicine, food Health care, chemical and agricultural industries. [0003] The synthesis methods of GABA include chemical synthesis and biosynthesis. Chemical synthesis of GABA requires strong corrosive solvents such as strong acids or alkalis. The reaction ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12P13/00C12R1/19
CPCC12N9/88C12N15/70C12P13/005C12Y401/01015
Inventor刘佳刘立明罗秋玲陈修来
OwnerJIANGNAN UNIV