Ochrobactrum-mediated transformation of plants
A technology of Bacillus pallidus and the genus Pallidum, which is applied in the field of plant biology and can solve problems such as low transformation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example
[0121] Those skilled in the art will recognize the many advantages of the methods and compositions provided herein. The following examples provide detailed specific studies, methods, and compositions, however, those skilled in the art will appreciate that many changes can be made in the specific examples disclosed and still obtain like or similar results without departing from the disclosure spirit and scope. All references cited herein are incorporated by reference in their entirety, including whether they supplement, explain, provide a background, or teach the methodology, technique, or composition employed herein.
[0122] Example 1 - Plasmid construction
[0123] Plasmid pVir8 (PHP70365; SEQ ID NO: 106) is a 38.8 kb vector with the vir gene and T-DNA, constructed in E. coli using standard molecular biology methods. It has two origins (ColE1, pVS1) to replicate stably in a wide range of bacteria and encodes resistance to the antibiotic gentamicin. It contains ~27 kb of...
example 2
[0136] Example 2 - Bacterial screening using transient DsRED expression in tobacco BY-2 suspension cultures
[0137] Tobacco BY-2 cells were provided by RIKEN BRC [RIKEN Bio-Resource Center] through the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT). Nagata et al. (IntRev Cytol [International Review of Cytology] (1992) 132: 1-30) primarily describe methods for maintaining tobacco BY-2 suspension cultures and an improved method using BY-2 suspension cells (Newman et al. (1993 ) Plant Cell [Plant Cell] 5:701-714) for transient expression of DsRED.
[0138] From the gentamicin-resistant strains transformed with PHP70365, 24 bacterial strains showed different levels of DsRED expression in BY-2 cells as observed under a Leica fluorescence stereomicroscope.
example 3-D
[0139] Example 3-DNA extraction and PCR of 16S rDNA
[0140] Various assays were performed to identify the Pallidum species used for plant transformation. First, use MasterPure TM Genomic DNA was prepared with a DNA purification kit (Cat#MCD85201, Epibio, Madison, WI, USA). Using genomic DNA extracted from 24 bacteria, PCR was performed with a PTC-100TM programmable thermal controller (MJ Research, Inc., San Francisco, CA, USA). Primers used for amplification were:
[0141] SEQ ID NO: 102 16S-F 5'AGAGTTTGATCCTGGCTCAG 3'
[0142] SEQ ID NO: 103 16S-R 5'ACGGCTACCTTGTTACGACTT 3'
[0143] The PCR mix consists of 5 μL (100-200ng) of bacterial DNA, 1.25 μL of 50 mM MgCl 2 , 0.25 μL of Taq DNA polymerase (5 U / μL, GIBCO BRL, Cleveland), 2.5 μL of 10x Taq buffer (GIBCO BRL), 0.5 μL of 10 mM dNTP, 10 μM primers, and 15 μL of sterile distilled water. The sample was heated to 94°C for 1 minute, followed by 30 cycles of 94°C (30 seconds), 50°C (30 seconds), 72°C (90 seconds), then ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



