Common wild rice green tissue specific expression gene promoter and application thereof

A green tissue and promoter technology, applied in the fields of application, genetic engineering, recombinant DNA technology, etc., can solve the problem of undetectable Bt protein

Active Publication Date: 2018-09-28
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Yang et al. fused the Cry1AcCry1l gene with the green tissue-specific promoter pGreen to transform the rice variety Xiushui-134. The enzyme-linked immunosorbent assay showed that the transgenic rice had better insect resistance, but almost no Bt protein was detected in the seeds (Yang Y Y ,Mei F,Zhang W,et al.Creation of Bt rice expressing a fusion protein of Cry1Ac and Cry1I-like using a green tissue-specific promoter[J].J Econ Entomol,2014,107(4):1674-1679.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Common wild rice green tissue specific expression gene promoter and application thereof
  • Common wild rice green tissue specific expression gene promoter and application thereof
  • Common wild rice green tissue specific expression gene promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Cloning of common wild rice green tissue-specific OrGSEp

[0041] Genomic DNA of common wild rice was extracted by CTAB method as a template, and the following amplification primers FP and RP were used as primers for PCR amplification, and the reaction system was 50 μL.

[0042] The primer sequences for amplifying OrGSEp-374 are:

[0043] F-374: (BamHI) ACGCGTAAGGGGATCCAGTCGTCGTCGTCGTACGTC,

[0044] R:(EcoR I)GATCTACCATGAATTCAGTCGTCGTCGTCGTACGTC;

[0045] The primer sequence of amplifying OrGSEp-274 is:

[0046] F-274: (BamH I)ACGCGTAAGGGGATCCATCCAAAACCGCCTTCAAAACC,

[0047] R:(EcoR I)GATCTACCATGAATTCAGTCGTCGTCGTCGTACGTC;

[0048] The primer sequence of amplifying OrGSEp-204 is:

[0049] F-204:(BamHI):ACGCGTAAGGGGATCCACCCGGTTTTGCGGTCGAGGGA,

[0050] R:(EcoR I)GATCTACCATGAATTCAGTCGTCGTCGTCGTACGTC;

[0051] The primer sequence of amplifying OrGSEp-114 is:

[0052] F-114:(BamHI):ACGCGTAAGGGGATCCCATTGGACTTGCCATCCTTTGG,

[0053] R:(EcoR I)GATCTACCATGAATTC...

Embodiment 2

[0068] Example 2. Functional research on the root-specific expression fragment OrGSEp of common wild rice

[0069] 1. Preparation of recombinant vector

[0070] The recombinant vector pBinGlyRed-GUS-OrGSEp374 is to replace the OrGSEp374 shown in sequence 1 with pBinGlyRed-GUS ( Figure 7 , Zhao Zhiqiang et al., Cloning and identification of a green tissue-specific expression promoter of common wild rice. Biotechnology Bulletin, 2017, (7): 51-57) the CaMV35S promoter driving GUS gene expression between the BamH I and EcoR I restriction sites of the vector, the vector obtained.

[0071] The recombinant vector pBinGlyRed-GUS-OrGSEp274 is a vector obtained by replacing the CaMV 35S promoter driving GUS gene expression between the BamH I and EcoR I restriction sites of the pBinGlyRed-GUS vector with OrGSEp274 shown in Sequence 2.

[0072] The recombinant vector pBinGlyRed-GUS-OrGSEp204 is a vector obtained by replacing the CaMV 35S promoter driving the expression of the GUS gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a common wild rice green tissue specific expression gene promoter and application thereof. The invention provides a DNA molecule which is a DNA molecule as follows: 1) a DNA molecule of which an encoding zone is shown in sequence 1 in a sequence table; 2) a DNA molecule of which an encoding zone is shown in sequence 2 in the sequence table; 3) a DNA molecule of which an encoding zone is shown in sequence 3 in the sequence table; 4) a DNA molecule of which an encoding zone is shown in sequence 4 in the sequence table; 5) a DNA molecule which is hybridized with any defined DNA sequence of 1)-4) under a strict condition and has functions same as those of the DNA sequences. The invention finds a novel green tissue specific promoter, and novel regulation and control elements are provided for genetic engineering breeding of rice.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a common wild rice green tissue specific expression gene promoter and application thereof. Background technique [0002] Promoters play a very critical role in the expression regulation of genes, and also play an important role in plant genetic engineering breeding. Plant promoters are mainly divided into three categories: constitutive promoters, inducible promoters, and tissue-specific promoters. In the field of plant genetic engineering, the most studied are inducible promoters and tissue-specific promoters. Wang et al. isolated the promoter of PeNAC1 gene from Populus euphratica and transformed it into Arabidopsis. After abiotic stress treatment and GUS activity analysis, it was found that the promoter of PeNAC1 was induced by drought and salt stress (Wang J Y, Wang J P, Yang HF. Identification and functional characterization of the NAC gene promoter from Populuseuph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82C12N15/11A01H5/00A01H6/20
CPCC07K14/415C12N15/8225
Inventor裴新梧龙艳薛满德赵志强
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI