Preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application

A high-yield Bacillus licheniformis technology, applied in the field of biotechnology and fermentation, can solve the problems of low synthesis amount and insufficient synthesis of target products

Active Publication Date: 2018-10-02
HUBEI UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Citric acid will be partially synthesized in the process of bacterial metabolism, but the ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application
  • Preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application
  • Preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] A method for constructing a bacillus licheniformis (Bacillus licheniformis) engineering bacterium capable of improving γ-PGA production, comprising the following steps:

[0034](1) Using the genomic DNA of Bacillus licheniformis WX-02 as a template, the upstream homology arm (555bp) of the cimH gene (shown in SEQ ID NO.1) and the downstream homology arm (518bp) of the cimH gene were amplified by PCR ; Upstream homology arm primers A-F and A-R, downstream homology arm primers B-F and B-R;

[0035] A-F: GCGAGCTCAAAATCCATAAGGCTCAC

[0036] A-R: CGCTCCGCCGATTCTTGTTCAAAGCGAAGAGCAGCA

[0037] B-F: TGCTGCTCTTCGCTTTGAACAAGAATCGGCGGAGCG

[0038] B-R: GCCGCTCTAGAAGAACCTGCACGCTATCCG;

[0039] (2) Connect the upstream homology arm and the downstream homology arm of the cimH gene by overlapping extension PCR, the primers used are A-F and B-R to form the target gene fragment (1073bp), the sequence of the target gene fragment is: cimH gene The upstream homology arm of - the downst...

Embodiment 2

[0051] The application of Bacillus licheniformis WX-02△cimH in the production of γ-PGA comprises the following steps:

[0052] 1) The specific steps for obtaining the seed solution are as follows: first activate Bacillus licheniformis WX-02△cimH, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 230r / min at 37°C After 12 hours, inoculate the bacterium solution after the activation of the strain on the seed medium with a volume percentage of 1% inoculum, and then cultivate it at 230r / min and 37°C for 12 hours to obtain the bacterium solution for seed cultivation;

[0053] The formula of described seed medium is LB formula (10g / L peptone, 5g / L yeast powder, 10g / L sodium chloride, pH7.2)

[0054] 2) In the 250mL Erlenmeyer flask, load 50mL of different formulations of fermentation media (see Table 1 for the specific formulation, pH7.20), then the bacterium solution of the seed culture is 3% (volume percentage) with the inoculum size, and the rota...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of biotechnology and fermentation and discloses a preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application.The preparation method is characterized in that on the basis of plasmid T2(2)-Ori, a cimH gene is successfully knocked out from bacillus licheniformis WX-02 by constructing a knockout vector T2-deltacimH of citric acid transporter gene cimH, and further engineered bacterium WX-02 deltacimH of the bacillus licheniformis is obtained. Compared with contrast bacterium WX-02, an engineered strain WX-02deltacimH has the advantages that the yield of gamma-PGA is at least improved by 11 percent or above, and a new strategy is provided for high yield of the gamma-PGA.

Description

technical field [0001] The invention relates to the fields of biotechnology and fermentation, in particular to a preparation method and application of a high-yield poly-γ-glutamic acid bacillus licheniformis. Background technique [0002] Poly γ-glutamic acid (γ-PGA) is an anionic glutamic acid polymer composed of D-glutamic acid, L-glutamic acid or D, L-glutamic acid, relative molecular weight In 10KD-3000KD. According to the amide bond connection mode between glutamic acid monomers, it can be divided into polyα-glutamic acid and polyγ-glutamic acid. There are free carboxyl groups in the molecular chain of γ-PGA, and the hydrogen bonds between molecules are composed of free carboxyl groups. Provide, so γ-PGA has many characteristics: easy to dissolve in water; good water retention capacity; adsorption of metal ions; the main chain is composed of peptide bonds, which can be degraded into short peptides or monomer amino acids under enzymatic degradation, so it is biodegradab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/75C12P13/02C12P13/14C12R1/10
CPCC07K14/32C12N15/75C12P13/02C12P13/14
Inventor 陈守文王世依蔡冬波何鹏辉陈耀中莫非马昕
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap