Check patentability & draft patents in minutes with Patsnap Eureka AI!

A method for constructing a mouse model of autism spectrum disorder

A mouse model, autism technology, applied to other methods of inserting foreign genetic material, using microinjection method, and cells modified by introducing foreign genetic material, etc., can solve the problem of unproven and established direct causality. , to achieve high accuracy and low off-target effect

Active Publication Date: 2022-06-21
SHANGHAI TECH UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a direct causal relationship between methylation of the MeCP2 gene and the ASD phenotype has not been proven and established

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing a mouse model of autism spectrum disorder
  • A method for constructing a mouse model of autism spectrum disorder
  • A method for constructing a mouse model of autism spectrum disorder

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] 1. Construction of site-directed methylation system plasmid

[0089] Design forward primer with NheI restriction site and 15bp backbone vector homology arm GGGAGACCCAAGCTGGCTAGCACCATGGGACCTAAGAAAAAGAGGAAGGTGGCGGCCGCTGGCGGCAGCATGTTCGAAACCGTGCCTGTG (SEQ ID NO: 1), reverse primer with 15bp homology arm CCTCTTCTCAGCTGGGTGGCTGCCGCGGGGCACTAGTCCGCTGCTGAAGCTGCGCCCGCTGCTTGA2μAAAACT IDTGAAATATTCT (SEQ ID NO:1). Human DNMT3L cDNA was amplified using Novozan high-fidelity enzyme kit (Vazyme, p501-d2) (the source was obtained by reverse transcription using a reverse transcription kit (Takara, DRR036A), template concentration: 1 ng / μl). The forward primer CCAGCTGAGAAGAGGAAGCCC (SEQ ID NO: 3) was designed, and the reaction primer had a 15 bp homology arm TAGAGTATTTCTTGTCGCTCTCGGGGGTGGCGCTCTCGCTGGTACCGGGGGTCTCGCTGCCGCT (SEQ ID NO: 4), which was dissolved in water to 10 μM. Human DNMT3A cDNA was amplified using Novozan high-fidelity enzyme kit (Vazyme, p501-d2) (the source was obtained ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing a mouse model of autism spectrum disorder, which is characterized in that it comprises: using embryo microinjection technology to inject a methylation carrier into the cytoplasm and targeting the MeCP2 gene TSS in the fertilized egg stage of the mouse The gRNA vector of the region is obtained to obtain a mouse model of autism spectrum disorder; wherein, the methylation vector contains a dCas9 fragment and human DNMT3L and DNMT3A catalytic domains. The site-specific methylation carrier of the present invention can effectively realize site-specific methylation in cells.

Description

technical field [0001] The invention relates to a site-specific methylation technology in mice, which belongs to the field of epigenetic editing, and more specifically relates to the fusion of CRISPR system and methyltransferase, combined with embryonic microinjection technology to carry out in vivo MeCP2 Gene-specific methylation to create a mouse model of autism spectrum disorder. This technology can also be used to simulate and construct mouse models of physiological state changes caused by abnormal methylation in the development of other genes, and to interfere with diseases caused by abnormal epigenetic modifications in vivo. Background technique [0002] Autism spectrum disorders (ASD) are a complex group of neurological disorders that affect 1.5% of newborn children. People with ASD have symptoms such as social impairment, anxiety, and repetitive stereotyped behaviors. ASD has a strong genetic component and clinical heterogeneity. More than 400 genes have been show...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/89C12N15/85C12N5/10A01K67/027
CPCA01K67/0275C12N15/85C12N15/89A01K2267/0318A01K2227/105A01K2217/07A01K2207/15
Inventor 陆宗阳刘真黄行许
Owner SHANGHAI TECH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More