A method for constructing a mouse model of autism spectrum disorder
A mouse model, autism technology, applied to other methods of inserting foreign genetic material, using microinjection method, and cells modified by introducing foreign genetic material, etc., can solve the problem of unproven and established direct causality. , to achieve high accuracy and low off-target effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] 1. Construction of site-directed methylation system plasmid
[0089] Design forward primer with NheI restriction site and 15bp backbone vector homology arm GGGAGACCCAAGCTGGCTAGCACCATGGGACCTAAGAAAAAGAGGAAGGTGGCGGCCGCTGGCGGCAGCATGTTCGAAACCGTGCCTGTG (SEQ ID NO: 1), reverse primer with 15bp homology arm CCTCTTCTCAGCTGGGTGGCTGCCGCGGGGCACTAGTCCGCTGCTGAAGCTGCGCCCGCTGCTTGA2μAAAACT IDTGAAATATTCT (SEQ ID NO:1). Human DNMT3L cDNA was amplified using Novozan high-fidelity enzyme kit (Vazyme, p501-d2) (the source was obtained by reverse transcription using a reverse transcription kit (Takara, DRR036A), template concentration: 1 ng / μl). The forward primer CCAGCTGAGAAGAGGAAGCCC (SEQ ID NO: 3) was designed, and the reaction primer had a 15 bp homology arm TAGAGTATTTCTTGTCGCTCTCGGGGGTGGCGCTCTCGCTGGTACCGGGGGTCTCGCTGCCGCT (SEQ ID NO: 4), which was dissolved in water to 10 μM. Human DNMT3A cDNA was amplified using Novozan high-fidelity enzyme kit (Vazyme, p501-d2) (the source was obtained ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



