Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene miR-140-3P associated with diagnosis and treatment of lung cancer and mimics thereof and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for gene expression and non-small cell lung cancer, applied in the fields of genetic engineering, medical preparations containing active ingredients, biochemical equipment and methods, etc. Early diagnosis rate is not high
Active Publication Date: 2019-01-18
SUZHOU GENEPHARMA
View PDF8 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, the early diagnosis rate of lung cancer is not high. Although there are some markers and imaging diagnostic methods, many lung cancer patients are diagnosed in the middle and late stage; Treatment (PD1 antibody) and surgical treatment
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0051] Example 1. Discovery of miR-140-3P as a diagnostic marker for non-small cell lung cancer
[0052] (1) miR-140-3P as a diagnostic marker for non-small cell lung cancer
[0053] The nucleotide sequence of miR-140-3P is as follows: UACCACAGGGUAGAACCACGG (SEQ ID NO: 1).
[0054] 1. miR-140-3P mRNA as a diagnostic marker for non-small cell lung cancer (qPCR)
[0056] A total of 52 samples were taken from hospital paraffin pathological sections or patients with non-small cell lung cancer pathologically diagnosed, including paracancerous tissues and tumor tissues (Table 1). The extraction method of total RNA was as follows:
[0057] 1) Take a total of 1 mL of Ezol lysate for the sample.
[0058] 2) Add 0.2 mL of chloroform, shake vigorously for 10 s, and place at room temperature for 3 minutes.
[0059] 3) Centrifuge at 12,000 rpm for 20 min at 4°C.
[0060] 4) Transfer the supernatant aqueous phase to another new RNase-free centrifuge tube, ...
Embodiment 2
[0111] Example 2, the application of substances that mimic the expression or activity of miR-140-3P in inhibiting tumor growth
[0112] 1. Mimics transfected cells
[0113] H226 cells were transfected with mimics that mimic the expression or activity of miR-140-3P and Control, respectively, to obtain H226 cells transfected with miR-140-3P and H226 cells transfected with control. Specific steps are as follows:
[0114] 1. When H226 cells (human lung squamous cell carcinoma cells) are cultured in a 10cm dish until they are 80-90% confluent, discard the culture medium and wash the cells twice with 3mL PBS.
[0115] 2. Add 1mL Trypsin-EDTA solution, mix well, carefully suck off the trypsin solution, and place at 37°C for 1 minute. Add 2 mL of complete medium and pipette to make the cells form a single-cell suspension.
[0116] 3. Count on a blood cell counting board, according to about 1×10 per well 5 Cells were seeded in 24-well plates.
[0117] 5. Add 1 μL Lipo2000 to the 2...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a Gene miR-140-3P associated with diagnosis and treatment of lung cancer and mimics thereof and application thereof. The invention provides a substance for enhancing or enhancing the expression of a miR-140-3P gene or a miR-140-3P mimetic in any one of the following 1)- 3): 1) preparing a tumor-treating product; 2) preparing A product that inhibits tumor cell proliferation;3) a product that inhibits tumor growth. The invention finds the use of the human miR-140-3P gene in the early diagnosis and treatment of non-small celllungcancer, and further constructs a human miR-140-3P gene mimics, which proves that the mimetic can effectively inhibit The growth of lungcancer cells is of great significance in the treatment of tumors, laying a foundation for the clinical treatment of non-small cellcarcinoma.
Description
technical field [0001] The invention belongs to the field of biotechnology and treatment, and in particular relates to the gene miR-140-3P related to the diagnosis and treatment of lung cancer and its mimics and applications. Background technique [0002] Lungcancer is a type of tumor with the highest incidence in the world and a very high degree of malignancy. According to statistics, in 2018, the number of lung cancer cases in the United States was 243,000, and 150,000 of them died of lung cancer. Lung cancer can be divided into non-small celllung cancer and small celllung cancer, of which non-small cell lung cancer accounts for about 80-85%, while small cell lung cancer accounts for about 10-15%. Non-small cell lung cancer can be subdivided into adenocarcinoma, squamous cell carcinoma, and large cellcarcinoma. The occurrence of lung cancer is usually related to factors such as smoking, lampblack and environmental pollution. At present, the early diagnosis rate of lu...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More