Serum miRNA marker and method thereof for detecting ionizing radiation injury by serum miRNA marker
A technology of ionizing radiation and markers, applied in the field of biomarkers, can solve the problems of unsatisfactory timeliness, convenience, stability and sensitivity, etc., achieve reliable and accurate detection results, and improve specificity and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] A serum miRNA marker that is a combination of miR-134-5p and miR-155-5p.
[0032] Among them: the mature sequence of miR-134-5p is 5'- UGUGACUGGUUGACCAGAGGGG -3'.
[0033] The mature sequence of miR-155-5p is 5'-UUAAUGCUAAUUGUGAUAGGGGU-3'.
[0034] The method for detecting ionizing radiation damage by serum miRNA markers comprises the following steps:
[0035] (1) Total RNA was extracted from serum samples of normal individuals.
[0036] Due to the low abundance of RNA in serum samples, it can be purified using miRNeasy Serum / Plasma Kit from QIAGENE. Before extraction, exogenous nematode cel-miR-39 was added as an internal reference for normalization of data after PCR reaction. The specific operation process is as follows:
[0037] ①Thaw the serum sample, add QIAzol Lysis Reagent 5 times the volume of the sample, and vortex to mix. For example, 1mL QIAzol Lysis Reagent should be added to 200ul serum.
[0038] ②Let stand at room temperature for 5min, then add 3.5ul...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com