Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of serum miRNA marker and the method for detecting ionizing radiation damage thereof

A technology of ionizing radiation and markers, applied in the field of biomarkers, can solve the problems of unsatisfactory timeliness, convenience, stability and sensitivity, etc., achieve reliable and accurate detection results, and improve specificity and sensitivity

Active Publication Date: 2021-10-08
INST OF MODERN PHYSICS CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main biomarkers detected by ionizing radiation include chromosomal aberrations in lymphocytes, cell micronuclei, and radiation-sensitive protein molecules, etc., but these markers still have deficiencies in terms of timeliness, convenience, stability, and sensitivity. ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of serum miRNA marker and the method for detecting ionizing radiation damage thereof
  • A kind of serum miRNA marker and the method for detecting ionizing radiation damage thereof
  • A kind of serum miRNA marker and the method for detecting ionizing radiation damage thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] A serum miRNA marker, which is a combination of miR-134-5P and miR-155-5P.

[0032] Among them: MiR-134-5P maturation sequence is 5'- ugugacugguugaccagagggggg -3 '.

[0033] The mature sequence of MIR-155-5P is 5'-uuaaughuaauugugauagggu-3 '.

[0034] The serum miRNA marker detects the method of electroplated radiation damage, including the following steps:

[0035] (1) Total RNA is extracted from normal individual serum samples.

[0036] Due to the low abundance of RNA in serum samples, it can be purified by Qiagene's Mirneasy Serum / Plasma Kit kit. Before the extraction, foreign nematodes Cel-miR-39 were added as internal paramers, and the normalization process of data after the PCR reaction was used. The specific procedure is as follows:

[0037] 1 Milled serum samples, add 5 times the Qiazol Lysis Reagent of the sample, and the vortex is mixed. 1 ml Qiazol Lysis Reagent is required such as 200 ul serum.

[0038] 2 Deposition at room temperature for 5 min, add 3.5 ul Cel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a serum miRNA marker, which is a combination of miR-134-5p and miR-155-5p. At the same time, the invention also discloses a method for detecting ionizing radiation damage by the serum miRNA marker. Compared with traditional chromosomal aberrations and protein biomarkers, the serum miRNA markers of the present invention are more stable in the extraction and storage process, making the detection results more reliable and accurate; and verified by qRT-PCR method, its expression level and radiation The dose is also closely related, which can provide a reliable and accurate assessment basis for judging whether the test object is at risk of being damaged by ionizing radiation.

Description

Technical field [0001] The present invention relates to the field of biomarkers, and more particularly to a serum miRNA marker and a method of detecting radiation injury. Background technique [0002] Ionospheric radiation is widely present in the space environment and nuclear adjusted facilities. On the one hand of ionizing radiation, it can act directly on the DNA, protein molecules, and artifacts, etc., resulting in structural damage and functional damage, on the other hand, can also act in a water molecule in cells and metamples, producing a large amount of strong oxidation resistance The free radical indirectly causes damage to the cell. Isolation radiation exceeding secure dose limits may result in acute radiation symptoms such as skin necrosis, retinal and lens lesions, digestive system damage, hematopoietic and immune system injury and organ failure, and also significantly increase the risk of cancer. With the rapid development of nuclear energy, radiation medicine, and s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12N15/113
CPCC12Q1/6883C12Q2600/158
Inventor 危文俊王菊芳华君瑞何进鹏
Owner INST OF MODERN PHYSICS CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More