A kind of serum miRNA marker and the method for detecting ionizing radiation damage thereof
A technology of ionizing radiation and markers, applied in the field of biomarkers, can solve the problems of unsatisfactory timeliness, convenience, stability and sensitivity, etc., achieve reliable and accurate detection results, and improve specificity and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] A serum miRNA marker, which is a combination of miR-134-5P and miR-155-5P.
[0032] Among them: MiR-134-5P maturation sequence is 5'- ugugacugguugaccagagggggg -3 '.
[0033] The mature sequence of MIR-155-5P is 5'-uuaaughuaauugugauagggu-3 '.
[0034] The serum miRNA marker detects the method of electroplated radiation damage, including the following steps:
[0035] (1) Total RNA is extracted from normal individual serum samples.
[0036] Due to the low abundance of RNA in serum samples, it can be purified by Qiagene's Mirneasy Serum / Plasma Kit kit. Before the extraction, foreign nematodes Cel-miR-39 were added as internal paramers, and the normalization process of data after the PCR reaction was used. The specific procedure is as follows:
[0037] 1 Milled serum samples, add 5 times the Qiazol Lysis Reagent of the sample, and the vortex is mixed. 1 ml Qiazol Lysis Reagent is required such as 200 ul serum.
[0038] 2 Deposition at room temperature for 5 min, add 3.5 ul Cel...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com