Method for enhancing acid resistance of L-asparaginase

A technology for asparaginase and construction method, which is applied in the field of enhancing the acid resistance of L-asparaginase, and can solve problems such as inactivation and protein variation.

Active Publication Date: 2019-03-19
JIANGNAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glycosylation is often used for protein labeling, affects the conformation of polypeptides, promotes its correct folding, changes protein water solubility, promotes protein expression, etc., but may also cause protein variation or inactivation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enhancing acid resistance of L-asparaginase
  • Method for enhancing acid resistance of L-asparaginase
  • Method for enhancing acid resistance of L-asparaginase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of recombinant plasmid fusion expressing L-asparaginase

[0037] Select the Aspergillus promoter Pgla, PgpdA or PaclA, and add 20bp upstream and downstream homology arms of the original promoter to the 5'and 3'ends of the selected promoter sequence (the upper and lower homology arm sequences are as SEQ ID NO. 5 and SEQ ID respectively). Shown in NO.6).

[0038] The markers include hygromycin B (hyg), orotidine-5'-phosphate dehydroxylase, acetamidase and other filamentous fungal markers with similar functions commonly used in Aspergillus. The hygromycin resistance gene in the recombinant plasmid is derived from the PAN7-1 plasmid, and the expression box primers are as follows (Hyg-F / R, see Table 1). If you want to choose other resistances, you can replace hyg in the expression box for construction.

[0039] Table 1 Primer list

[0040] Primer name

Primer sequence

Hyg-F

GAATTCCCTTGTATCTCTACACACAG

Hyg-R

TGAAGAACGAATACCGCGACATCCAACCCATC

[0041] ...

Embodiment 2

[0045] Example 2 Changes in enzyme properties of recombinant L-asparaginase

[0046] The obtained recombinant Aspergillus niger was inserted into YPM medium, and fermented for 72-120h at 250rpm and 30°C. The L-asparaginase before and after the fusion glucoamylase catalytic region was expressed and purified by a nickel column. The recombinant bacteria fermentation broth was centrifuged at 10,000 rpm for 10 min to separate the bacteria from the fermentation supernatant, and the supernatant was collected and purified through a 0.22 μm filter membrane. Sample by Ni 2+ Purified by affinity chromatography column (GE Histrap FF 5mL) to obtain recombinant L-asparaginase.

[0047] Take 10 μL of the purified sample and perform SDS-PAGE electrophoresis. The protein band without the catalytic region of saccharification enzyme is about 42kDa in size, and a band of about 55kDa appears after fusion. Use NEB's deglycosylase EndoH (29kDa) to digest and recover the fused sample band figure 2 Afte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for enhancing the acid resistance of L-asparaginase and belongs to the technical field of enzyme engineering. According to the method, aspergillus niger derived L-asparaginase and a glucoamylase catalysis region are subjected to fusion expression to change the glycosylation degree, so that the enzymatic property of the L-asparaginase is changed. By adopting the method provided by the invention, the most proper pH (Potential of Hydrogen) of the obtained recombinant L-asparaginase is changed to 5 from 7.5 and the property is changed into acidity from alkalinity;60 percent of the enzyme activity still can be kept under the condition that the pH is 3; and the properties are good for further application of the L-asparaginase in the field of food processing.

Description

Technical field [0001] The invention relates to a method for enhancing the acid resistance of L-asparaginase and belongs to the technical field of enzyme engineering. Background technique [0002] L-asparaginase amidohydrolase (L-asparaginase amidohydrolase, E.C.3.5.1.1) is a hydrolase that specifically hydrolyzes asparagine. There are three types of L-asparaginase, I, II, and III. Among them, the type II L-asparaginase has a good application prospect. On the one hand, it can be used in the pharmaceutical industry to treat cancers such as acute myeloid leukemia; On the one hand, it can reduce the production of carcinogenic acrylamide in food processing in the food industry, especially in baked foods, fried foods, etc. [0003] Type Ⅱ L-asparaginase has abundant sources, and the enzymatic properties of different sources show certain differences. The enzyme molecule is a tetramer, contains four subunits, and has a molecular weight of 43kDa. Among them, the optimal pH of L-asparagin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/62C12N9/82C12R1/685
CPCC07K2319/00C12N9/82C12N15/80C12Y305/01001
Inventor刘松李岑陈坚堵国成
OwnerJIANGNAN UNIV