A kind of method for enhancing the acid resistance of l-asparaginase

A technology of asparaginase and construction method, which is applied in the field of enhancing the acid resistance of L-asparaginase, and can solve problems such as protein variation and inactivation

Active Publication Date: 2020-06-16
JIANGNAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glycosylation is often used for protein labeling, affects the conformation of polypeptides, promotes its correct folding, changes protein water solubility, promotes protein expression, etc., but may also cause protein variation or inactivation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method for enhancing the acid resistance of l-asparaginase
  • A kind of method for enhancing the acid resistance of l-asparaginase
  • A kind of method for enhancing the acid resistance of l-asparaginase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 The recombinant plasmid construction of fusion expression L-asparaginase

[0037] Select the Aspergillus promoter Pgla, PgpdA or PaclA, and add a homology arm of 20 bp upstream and downstream of the original promoter at the 5' and 3' ends of the selected promoter sequence (the upper and lower homology arm sequences are respectively as SEQ ID NO.5 and SEQ ID shown in NO.6).

[0038] Markers include hygromycin B (hyg) commonly used in Aspergillus, orotidine-5'-phosphate dehydroxylase, acetamidase and other filamentous fungal markers with similar efficacy. The hygromycin resistance gene in the recombinant plasmid is derived from the PAN7-1 plasmid, and the primers for the expression cassette are as follows (Hyg-F / R, see Table 1). If you want to select other resistances, you can replace hyg in the expression cassette for construction.

[0039] Table 1 Primer list

[0040] Primer name Primer sequence Hyg-F GAATTCCCTTGTATCTCTACACACAG Hyg...

Embodiment 2

[0045] Embodiment 2 Recombinant L-asparaginase enzymatic property change

[0046] The obtained recombinant Aspergillus niger was inserted into YPM medium, 250rpm, 30°C, and fermented for 72-120h. The L-asparaginase before and after the catalytic region of the glucoamylase was expressed and then purified by nickel column respectively. Centrifuge the fermentation broth of the recombinant bacteria at 10,000 rpm for 10 minutes to separate the bacteria from the fermentation supernatant, and collect the supernatant through a 0.22 μm filter membrane for purification. The sample was subjected to Ni 2+ Recombinant L-asparaginase was purified by affinity chromatography column (GE Histrap FF 5mL).

[0047] Take 10 μL of the purified sample for SDS-PAGE electrophoresis detection, the protein band size of the unfused glycoamylase catalytic region is about 42 kDa, and a band of about 55 kDa appears after fusion. Use NEB's deglycosylation enzyme EndoH (29kDa) to digest and recover the fus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for enhancing the acid resistance of L-asparaginase and belongs to the technical field of enzyme engineering. According to the method, aspergillus niger derived L-asparaginase and a glucoamylase catalysis region are subjected to fusion expression to change the glycosylation degree, so that the enzymatic property of the L-asparaginase is changed. By adopting the method provided by the invention, the most proper pH (Potential of Hydrogen) of the obtained recombinant L-asparaginase is changed to 5 from 7.5 and the property is changed into acidity from alkalinity;60 percent of the enzyme activity still can be kept under the condition that the pH is 3; and the properties are good for further application of the L-asparaginase in the field of food processing.

Description

technical field [0001] The invention relates to a method for enhancing the acid resistance of L-asparaginase, which belongs to the technical field of enzyme engineering. Background technique [0002] L-asparaginase amidohydrolase (E.C.3.5.1.1) is a hydrolase that specifically hydrolyzes asparagine. There are three types of L-asparaginase Ⅰ, Ⅱ, and Ⅲ, among which type Ⅱ L-asparaginase has good application prospects. On the one hand, it can be used in the pharmaceutical industry to treat cancers such as acute myeloid leukemia; on the other hand On the one hand, it can reduce the formation of carcinogenic acrylamide in food processing in the food industry, especially in baked food, fried food, etc. [0003] Type Ⅱ L-asparaginase has abundant sources, and the enzymatic properties of different sources show certain differences. The enzyme molecule is a tetramer with four subunits and a molecular weight of 43kDa. Among them, the optimum pH of L-asparaginase is mainly concentrated...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/62C12N9/82C12R1/685
CPCC07K2319/00C12N9/82C12N15/80C12Y305/01001
Inventor刘松李岑陈坚堵国成
OwnerJIANGNAN UNIV