Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid aptamer capable of detecting human colon cancer and application thereof in preparing detection preparations

A nucleic acid aptamer and colon cancer technology, which is applied in measuring devices, biochemical equipment and methods, instruments, etc., can solve the problems of missed treatment period, early detection and diagnosis of diseases, etc., and achieve easy modification and labeling, and accurate diagnosis , the effect of quick positioning

Active Publication Date: 2019-04-16
HUNAN UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, endoscopic examination is an invasive examination method, which has certain discomfort and complications, which makes people feel fearful. As a result, some colorectal diseases cannot be detected and diagnosed early, and the best treatment period is missed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer capable of detecting human colon cancer and application thereof in preparing detection preparations
  • Nucleic acid aptamer capable of detecting human colon cancer and application thereof in preparing detection preparations
  • Nucleic acid aptamer capable of detecting human colon cancer and application thereof in preparing detection preparations

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Determination of sequences with the highest binding ability to colon cancer cell lines

[0030] First, all the sequences in the Swan library were diluted with DPBS to a final concentration of 250nM, denatured at 95°C for 5min, refolded on ice for 10min, and then placed at room temperature. Secondly, the adherent colon cancer cells were digested from the culture dish with 0.2% EDTA and collected into centrifuge tubes, washed and centrifuged several times with washing buffer (DPBS, 0.45% glucose, 5 mM magnesium chloride) . Then add the prepared aptamer sequence and binding buffer (Binding Buffer: DPBS, 0.45% glucose, 5 mM magnesium chloride, 100mg / L tRNA, 1g / L BSA) to the cells respectively. The whole mixed system was incubated on a shaker at 4°C for 1 h, then washed and centrifuged twice with washing buffer (Washing Buffer: DPBS, 0.45 % glucose, 5 mM magnesium chloride), and finally the fluorescence was detected by flow cytometry (results in figure 1 ). Tes...

Embodiment 2

[0031] Embodiment 2: DML7 specifically recognizes colon cancer cells

[0032] This experiment was similar to that of Example 1. Firstly, the DML7 and control sequences were diluted with DPBS to a final concentration of 250nM, and then denatured and refolded. Then, colon cancer cells (HCT116, HT29, LoVo, Caco2, SW620, HCA7, DLD1) and human normal intestinal epithelial cells (FHs74Int, NCM460) attached to the culture dish were digested with 0.2% EDTA and collected. In a centrifuge tube, wash several times by centrifugation with washing buffer (Washing Buffer: DPBS, 0.45% glucose, 5 mM magnesium chloride). Add the prepared DML7 and control sequences to colon cancer cells (HCT116, HT29, LoVo) and human normal intestinal epithelial cells (FHs74Int, NCM460) respectively, and add binding buffer (Binding Buffer: DPBS, 0.45% glucose, 5 mM MgCl, 100mg / L tRNA, 1g / L BSA). The mixed system was incubated on a shaker at 4°C for 1 h. After incubation, it was washed and centrifuged twice wi...

Embodiment 3

[0033] Embodiment 3: the method for truncating DML7 sequence

[0034] Deletion and optimization of DML7 was performed as follows (the underlined part is the conserved nucleotide sequence of DML7):

[0035] The full length of the DML7 sequence is:

[0036] 5'-ACGCTCGGATGCCACTACAGG TTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAA CGAGAGGTCACCAGCACGTCCATGAG-3'.

[0037] : (Delete 11 bases from the primer region on the left)

[0038] CCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG

[0039] DML7-b: (Delete 3 bases in the left primer region, delete 9 bases in the right primer region)

[0040] CTCGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCAC

[0041] DML7-c: (Delete 13 bases in the left primer region, delete 19 bases in the right primer region)

[0042] AGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGG

[0043] DML7-d: (Delete 5 bases in the left primer region, delete 7 bases in the right primer region)

[0044] CGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer capable of achieving targeted detection of colon cancer cells and application thereof. The nucleotide sequence of the nucleic acid aptamer is 5'-ACGCTCGGATGCCACTACACGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG-3'. The nucleic acid aptamer is good in stability, target molecules can be specifically identified, the immunogenicity in thebody is small, and the target molecules can be easily removed. The aptamer is small in molecular weight and low in preparation cost, can be obtained through chemical synthesis in vitro, and is easy tostore and transport. By adopting the nucleic acid aptamer, various colon cancer cells can be detected, the operation is simple and quick, and early diagnosis, targeted treatment, prognosis and the like of colon cancer are facilitated.

Description

technical field [0001] The invention relates to a nucleic acid aptamer and its application, in particular to a nucleic acid aptamer which can be used for detection of human colon cancer cells and clinical sample tissues and an application method for preparing a detection reagent. Background technique [0002] Colorectal cancer is a highly malignant tumor of the digestive system, and its global mortality rate ranks third. The occurrence of colorectal cancer is closely related to in vitro environment and internal factors. Eating habits (such as long-term high-calorie, high-fat diet) and lifestyle (such as lack of exercise) in the in vitro environment are the incentives for the occurrence of colorectal cancer. Internal factors are mainly related to family genetic history, such as familial adenomatous polyposis family (FAP), hereditary nonpolyposis colorectal cancer family (HNPCC). With the rapid economic development, people's living standards are improving day by day, and eat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115G01N33/574
CPCG01N33/57419C12N15/115C12N2310/16
Inventor 胡小晓谭蔚泓彭程廖涛文超琪
Owner HUNAN UNIV