Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor marker STAMP-EP6 based on methylated modification

A methylation and tumor technology, applied in the direction of recombinant DNA technology, biochemical equipment and methods, microbial determination/testing, etc., can solve the problem of insufficient sensitivity and specificity, misdiagnosis, and affecting the sensitivity and accuracy of markers And other issues

Active Publication Date: 2019-04-19
SHANGHAI EPIPROBE BIOTECH CO LTD
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many deficiencies in this technique: first, the sensitivity and specificity are not high enough, the tumor itself has great heterogeneity, including cell populations of various subtypes, and the proportion of tumor DNA in clinical samples, especially blood samples, is very small , the existing tumor markers are difficult to meet the sensitivity of clinical requirements, and it is easy to cause misdiagnosis in the clinic; secondly, a marker only has a good effect on one or a few types of tumors, and the source of DNA in blood is very complicated. Therefore, the existing tumor markers cannot deal with complex issues such as tumor origin and metastasis
Due to the existence of these complex situations, it is difficult to have a uniform standard of use for many DNA methylation tumor markers in clinical application, which seriously affects the sensitivity and accuracy of the markers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor marker STAMP-EP6 based on methylated modification
  • Tumor marker STAMP-EP6 based on methylated modification
  • Tumor marker STAMP-EP6 based on methylated modification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1, the nucleic acid sequence detected for STAMP-EP6

[0074] The sequence of the STAMP-EP6 tumor marker is provided, as shown in the following SEQ ID NO: 1 (chr2: 200327093-200327623 / hg19), wherein the underline indicates that the base is a methylated CpG site, and the number below the underline indicates the position of the site Numbering.

[0075]

[0076] The above sequence of SEQ ID NO:1 is treated with bisulfite and the sequence is as follows: SEQ ID NO:2 (wherein Y represents C or U):

[0077]

[0078]

[0079] The reverse complementary sequence of the nucleotide sequence shown in the above SEQ ID NO:1 is as follows: SEQ ID NO:3:

[0080] CG CCTAG CG CAGACT CG TTGCCCACCATCCTTCCCCCATCAGT CG TCCCTCTGAGG CG TATCTCTCTGCT CG GGC CG CAGGGGCTCATT CG CTTGGGGC CG GGAGGAGGACCTCCACAGTCTCTACCTC CG G CG GC CG A CG GCTTCCTTCCCTCTC CG CCCC CG CCCAGACCCCCTGAGCTGC CG GGGGAGCCAGGAGTCATTTATCTTTGCCTGG CGCG GGTTGGGATTTGTC CG GCTCTG...

Embodiment 2

[0083] Example 2. Differences in the methylation of STAMP-EP6CpG sites between tumor cells and non-tumor cells—BSP-Bisulfite Sequencing PCR after bisulfite treatment

[0084] 1. Extract the genomic DNA of the liver cancer cell line HepG2 and the normal liver cell line;

[0085] 2. Treat the extracted HepG2 and normal liver cell line genomic DNA with bisulfite, respectively, as templates for subsequent PCR amplification;

[0086] 3. Design amplification primers (SEQ ID NO:5~6; Table 1) according to the sequence of SEQ ID NO:1, and routinely design primers to amplify;

[0087] 4. After PCR amplification, 2% agarose gel electrophoresis was used to detect the specificity of the PCR fragment, the gel was cut to recover the target fragment, ligated and inserted into the T vector, transformed into competent E. 10 clones were picked for Sanger sequencing.

[0088] Table 1, BSP primers

[0089]

[0090] The results of BSP verification of the methylation level of liver cancer cell...

Embodiment 3

[0091] Example 3. Differences in methylation of STAMP-EP6 CpG sites between tumor cells and non-tumor cells—Pyrosequencing

[0092] 1. Obtain clinical samples: Obtain para-cancer / non-cancer-cancer tissue samples from the clinic, para-cancer / non-cancer samples are used as the control group, and cancer tissue samples are used as the tumor detection experimental group;

[0093] 2. DNA extraction: extract the DNA of the experimental group and the control group respectively; this experiment uses the phenol-chloroform extraction method, but is not limited to this method;

[0094] 3. Bisulfite treatment: treat the extracted DNA samples with bisulfite, and operate in strict accordance with the steps; in this experiment, EZ DNA Methylation-Gold Kit from ZYMO Research Company, Cat. No. D5006 was used, but not limited to this kit;

[0095] 4. Primer design: According to the characteristics of STAMP-EP6 sequence SEQ ID NO: 1, design PCR amplification primers and pyrosequencing primers to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a methylation tumor marker STAMP-EP6 and application thereof, and belongs to the field of disease diagnosis markers. The invention provides application of the methylation tumormarker STAMP-EP6 in preparing a tumor diagnosis reagent. The tumor marker STAMP-EP6 is highly methylated in all tumor types, and is lowly methylated in corresponding normal tissue, and has high sensibility and specificity, and a primer for detecting the STAMP-EP6 can be used for preparing a tumor diagnosis kit.

Description

technical field [0001] The invention belongs to the field of disease diagnostic markers, more specifically, the invention relates to a tumor marker STAMP (Specific Tumor Aligned Methylation of Pan-cancer) based on methylation modification. Background technique [0002] The notion that tumors are considered to be a genetic disease persisted in the field for decades. Large-scale sequencing of several human systems has confirmed that the number of somatic mutations in cancer tissues is significantly less than expected, and these results imply that cancer is not a simple genetic disease. [0003] In order to realize the diagnosis of tumors, many new tumor markers have been discovered and used in clinical diagnosis in recent years. Before 1980, tumor markers were mainly cell secretions such as hormones, enzymes, and proteins, such as carcinoembryonic antigen (CEA), alpha-fetoantigen (AFP), etc., which can be used as markers for various tumors such as gastric cancer and liver can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/156C12Q2600/154C12Q2600/118C12Q1/6806
Inventor 李振艳罗怀兵
Owner SHANGHAI EPIPROBE BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More