Construction method and application of high-yield L-threonine gene engineering bacterium

A technology of genetically engineered bacteria and threonine, which is applied in the field of genetic engineering and microbial fermentation, can solve the problems of the theoretical conversion rate gap and other problems, and achieve the effects of saving fermentation costs, accelerating the growth of strains, and improving the conversion rate

Active Publication Date: 2019-05-10
JIANGNAN UNIV
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although the output of L-threonine in large-scale industrial production has reached 120g / l now, there is still a large gap between its conversion rate (40%-50%) and theoretical conversion rate (81%)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of high-yield L-threonine gene engineering bacterium
  • Construction method and application of high-yield L-threonine gene engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of pTargetF-arcA, pTargetF-iclR, pTargetF-tdcC knockout plasmids

[0029] Using pTargetF as a template, three pairs of primers, sgRNA-arcA-F and T-sgRNA-R, sgRNA-iclR-F and T-sgRNA-R, sgRNA-tdcC-F and T-sgRNA-R, were used for PCR amplification respectively. The PCR products were detected by gel electrophoresis, and the size of the obtained products met the expected size. The purified linear pTargetF-arcA, pTargetF-iclR, and pTargetF-tdcC fragments were obtained using a gel recovery kit, and then 200ng of the above fragments were respectively taken and added to 0.5ul DpnⅠ, 1ul DpnⅠbuffer, 6ul ddH 2 O Place in a 37°C water bath to digest the template plasmid pTargeTF, then add 2ul PNK phosphorylase and 2ul buffer, 6ul ddH 2 O was placed in a water bath at 37°C for phosphorylation, then placed in a water bath at 65°C for 10 minutes to inactivate the enzyme, and finally T4 DNA ligase was added and placed at 22°C for 4 hours. Transform the above lig...

Embodiment 2

[0034] Embodiment 2: construction of arcAUD, iclRUD, tdccUD knockout fragment

[0035]According to the gene sequences of arcA (SEQ ID NO.1), iclR (SEQ ID NO.2), and tdcC (SEQ ID NO.3) reported by Genebank, fragments of about 500 bp in size from the upstream and downstream of the gene were selected as the upstream and downstream homology of the knockout gene Arm, where arcAU, arcAD are used for knockout of arcA gene; iclRU, iclRD are used for knockout of iclR gene; tdccU, tdccD are used for knockout of tdcc gene. The following 6 pairs of primers were designed and used to clone arcAU, arcAD, iclRU, iclRD, tdccU, tdccD sequences respectively:

[0036] arcAf1:ACGCATATTGCCACTTCTTCT

[0037] arcAr1: TTACGAATACGGCGGATCTGCGTGTTACCAACTCGTC

[0038] arcAf2: GACGAGTTGGTAACACGCAGATCCGCCGTATTCGTAA

[0039] arcAr2: GCAAGCGGTATTGAAAGG

[0040] iclRf1:ATCGCAATGGTCGTGGAG

[0041] iclRr1: GACACCCTTATTCTATTGCCACGTTTATGCCAGTATGGTTTG

[0042] iclRf2: CAAACCATACTGGCATAAACGTGGCAATAGAATAAGGGTGT...

Embodiment 3

[0049] Embodiment 3: construction of arcA, iclR, tdcC deletion strain

[0050] Using Escherichia coli TWF001 (published in the paper "Increasing L-threonine production in Escherichia coli by engineering the glyoxylate shunt and the l-threonine biosynthesis pathway" in 2018) as the starting strain, electroporation knockout plasmid pTargetF-arcA, and knockout Insert the fragment arcAUD into TWF001 to construct the deletion strain TWF001 to delete arcA. The specific operation process is as follows:

[0051] (1) Extract the plasmid pTargetF-arcA from Escherichia coli JM109, and wash it with pH 8.0 water for later use.

[0052] (2) Electroporation of the knockout plasmid pTargetF-arcA and the knockout fragment arcAUD to Escherichia coli TWF001 containing pCas, the bacterial solution was spread on an LB plate containing kanamycin and spectinomycin for cultivation, and the correct transformant was obtained by screening.

[0053] (3) The transformants of (2) were induced by IPTG and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of a high-yield L-threonine gene engineering bacterium and belongs to the technical field of gene engineering and microbial fermentation.By means of deletion of an arcA gene encoding a transcription regulatory factor, deletion of an iclR gene encoding transcription repression and deletion of a tdcC gene encoding a threonine transporter, the yield of L-threonine is greatly improved, the yield of L-threonine is increased to 20.1 g / L after 36 hours of fermentation, and the conversion rate reaches 0.67.

Description

technical field [0001] The invention relates to a construction method and application of a high-yielding L-threonine genetically engineered bacterium, belonging to the technical fields of genetic engineering and microbial fermentation. Background technique [0002] L-threonine, formula C 4 h 9 NO 3 , relative molecular weight 119.12, white crystal or crystalline powder, is one of the essential amino acids for the human body. Threonine is a chiral compound, which has four isomers: L-threonine, D-threonine, L-allo-threonine and D-allo-threonine, which have physiological activity and natural Only L-threonine is present. [0003] In the field of food, L-threonine is widely used as a food fortifier, which can improve the nutritional value of food, relieve fatigue, and promote growth and development. L-threonine can be used in combination with other amino acids to play an anti-oxidative effect, and it will produce a burnt aroma when heated together with glucose. [0004] In ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/10C12P13/08C12R1/19
Inventor王小元丁志祥胡晓清朱丽飞柳亚迪
OwnerJIANGNAN UNIV