Check patentability & draft patents in minutes with Patsnap Eureka AI!

Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker

A technology of rice wax gene and fluorescent molecules, which is applied in the measurement/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of cumbersome process, low efficiency, and long time consumption, and achieve accurate results and low cost , the effect of easy operation

Inactive Publication Date: 2019-05-10
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the above technical problems, the present invention discloses a fluorescent molecular marker of the rice waxy gene Wx and its application. The detection sample is only amplified by PCR once without electrophoresis detection, and the amplification is directly obtained on the original plate with a fluorescent scanner. Data, Get Rice Wx a and Wx b genotype data; easy to operate, fast, low cost, accurate results, and solve the shortcomings of the currently used methods due to the time-consuming implementation process, cumbersome process, low efficiency and the use of toxic substances

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker
  • Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker
  • Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The preferred embodiments of the present invention will be further described in detail below.

[0031] A fluorescent molecular marker of the rice waxy gene Wx, which is obtained by amplifying the following fluorescent molecular marker primers of the rice waxy gene Wx to identify the waxy allele Wx a and Wx b The schematic diagram of the amplification is as figure 1 shown. Primers include RWx-FG primers, RWx-FT primers, RWx-R primers, #1 universal primers, #2 universal primers, the sequence of the RWx-FG primers is shown in SEQ ID NO: 1, and the RWx-FT primers The sequence of the RWx-R primer is shown in SEQ ID NO: 2, the sequence of the RWx-R primer is shown in SEQ ID NO: 3, the sequence of the #1 universal primer is shown in SEQ ID NO: 4, and the #2 universal primer The sequence of the primer is shown in SEQ ID NO:5.

[0032] Forward primer RWx-FG:

[0033] GAAGGTGACCAAGTTCATGCTTCATCAGGAAGAACATCTGCAAGG;

[0034] Forward primer RWx-FT:

[0035] GAAGGTCGGAGTCAACGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescent molecular marker of a rice waxy gene Wx and application of the fluorescent molecular marker. Primers of the fluorescent molecular marker comprise an RWx-FG primer,an RWx-FT primer, an RWx-R primer, a first universal primer and a second universal primer, wherein the sequence of the RWx-FG primer is shown in SEQ ID NO:1, the sequence of the RWx-FT primer is shown in SEQ ID NO:2, the sequence of the RWx-R primer is shown in SEQ ID NO:3, the sequence of the first universal primer is shown in SEQ ID NO:4, and the sequence of the second universal primer is shownin SEQ ID NO:5. According to the technical scheme, a test sample is subjected to PCR amplification only once, no electrophoresis detection is required, and amplification data is obtained by directlyusing a fluorescence scanner on an original plate; the operation is simple, convenient and rapid, the cost is low, the result is accurate, and the real closed-tube operation is achieved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a fluorescent molecular marker of rice waxy gene Wx and an application thereof. Background technique [0002] Rice is an important food crop. More than 100 countries in the world grow rice, and two-thirds of the world's population uses rice as a staple food. With the development of social economy and the improvement of consumption level, people have higher and higher requirements for rice quality and safety. High-quality soft rice has the characteristics of good taste, high elasticity, and is not easy to harden after cold, which is loved by most consumers. An important factor affecting the cooking quality of rice is the quality of starch deposited in the endosperm, which is divided into amylose and amylopectin, and amylose is one of the main indicators for identifying rice quality. The amylose content in rice is high, the gelatinization temperature is often...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
Inventor 邓国富黄娟高利军戴高兴卿冬进高菊梁海福伍豪周维永周萌陈韦韦
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More