Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

48results about How to "Realize closed tube operation" patented technology

Micro-fluidic chip and detecting device suitable for PCR (polymerase chain reaction) or HRM (high resolution melting) detection analysis

The invention discloses a micro-fluidic chip and a detecting device suitable for PCR (polymerase chain reaction) or HRM (high resolution melting) detection analysis. A micro pipeline and an array reaction chamber base plate form a combined mould, a micro-fluidic base chip is generated by virtue of an injection molding method, the micro-fluidic chip is formed by virtue of plasma cleaning and glass bonding; a rotary rod with a handle and a duct is transversely embedded in an outward channel center of the chip to form a rotary valve; the handle rotates to disconnect the duct to control on-off and sealing of multi-reaction-chamber sampling, so that physical isolation between reaction chambers is realized, the sealing performance is good, and cross contamination does not exist, and thus, a plurality of samples can be detected at the same time. The micro-fluidic chip disclosed by the invention not only can be used for independent PCR detection or HRM detection, but also can be used for performing PCR detection and then performing HRM detection without any change in a combined manner, so that the multi-functionalization of detection is realized.
Owner:HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI +1

Primer, reagent box and method for detecting salmonella and integron (int)

The invention discloses primer, a reagent box and a method for detecting salmonella and integrin (int). The primer comprises upstream primer SLMF: TGCGTCAGGACCTCATAG, downstream primer SLMR: ATGCCTGGAGGAGTGTTT, upstream primer intF: TTTACGCTGCTGTATGGT, and downstream primer intR for detecting int: TTATTGCTGGGATTAGGC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA and performing PCR amplification. After amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.
Owner:蔡先全

Kit for detecting drug resistance of mycobacterium tuberculosis based on HRM technology and primers thereof

The invention relates to a kit for detecting the drug resistance of mycobacterium tuberculosis based on an HRM technology and primers thereof. The invention discloses the kit for detecting drug resistance genes of the mycobacterium tuberculosis and application thereof. The invention discloses a group of primers for detecting whether each of the genes of the mycobacterium tuberculosis in a to-be-tested sample generates a drug resistance mutation or not, and the sequences of the primers are shown in SEQ NO.1-SEQ NO.10. The kit containing the primers can detect the mutation situations of the four drug resistance indicator genes (embB, rpsL, inhA and katG) in DNA extracted from the to-be-tested sample. The kit provided by the invention detects the mutation situations of the four drug resistance indicator genes of the mycobacterium tuberculosis in the to-be-tested sample within a shorter time through the high resolution melting (HRM) technology and is high in result sensitivity, better in specificity, and simple and convenient in analysis process.
Owner:SUZHOU BAIYUAN GENT CO LTD

Method for identifying five dermatophytes by utilizing high-resolution melting curve

The invention provides a method for identifying five dermatophytes by utilizing a high-resolution melting curve and belongs to the technical field of high-resolution melting curve analysis. The methodadopts a pair of specific primers and is based on real-time fluorescence PCR melting curve to identify trichophyton rubrum, trichophyton digitorum, epidermophyton floccosum, microsporum caninum and Microsporum incurvatum. The sequence of the pair of specific primers is as shown as SEQ ID NO.1-2. The method has the advantages of high sensitivity, good specificity and high detection speed, can be used for identifying dermatophytes on the aspects of clinical diagnosis, environmental monitoring, food safety and the like, and provides a reliable basis for infection treatment, environmental sanitation and food safety monitoring of dermatophytes.
Owner:JINHUA MUNICIPAL CENT HOSPITAL

Novel coronavirus SARS-CoV-2 detection and molecular typing method and kit

ActiveCN112626272ATm values ​​do not overlapIdiosyncratic and sensitive reactionsMicrobiological testing/measurementMicroorganism based processesReverse transcriptaseMolecular typing
The invention provides a novel coronavirus SARS-CoV-2 detection and molecular typing method and a kit. The method utilizes the combination of one-step multiple RT-PCR and HRM analysis to simultaneously realize the detection and typing of SARS-CoV-2. The detection method comprises the following steps of: 1) extracting sample nucleic acid; 2) completing one-step multiple RT-PCR reaction in a special primer group and a reagent; and 3) analyzing and interpreting SARS-CoV-2 detection results and molecular typing results by HRM. The kit provided by the invention comprises multiple special primers for detecting SARS-CoV-2 and performing molecular typing on the SARS-CoV-2, and also comprises reaction components Master Mix (RNA reverse transcriptase, polymerase, amplification buffer, dNTP and EvaGreen fluorescent dye), positive control and negative control.
Owner:INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI

HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus

The invention discloses an HRM identification method, a kit and a primer group for muscovy duck parvovirus (MDPV) and goose parvovirus (GPV). A test method comprises the following steps: (1) designing a group of universal PCR primers capable of being used for simultaneously augmenting the muscovy duck parvovirus and the goose parvovirus; (2) extracting DNA (Deoxyribonucleic Acid) of a viral genome from a to-be-tested sample as template DNA; (3) treating the template DNA through a PCR (Polymerase Chain Reaction) amplification process by use of the primer group mentioned in the step (1); (4) treating an amplification product through HRM analysis, and identifying the MDPV and the GPV. The method disclosed by the invention can be used for rapidly and effectively identifying the MDPV and the GPV; high test speed and high throughput are achieved; the test of a PCR product of a 96 / 384 pore plate can be finished within 5-10 minutes, so that the test time is greatly shortened; no injury is caused to the PCR product, and subsequent analysis, such as sequencing and gel electrophoresis, can be implemented after the test.
Owner:INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI

Method and kit for multiple detection of drug resistance sites of neisseria gonorrhoeae

The invention belongs to the technical field of molecular biology detection, and relates to a detection method for drug resistance sites, in particular to a method and a kit for multiple detection ofthe drug resistance sites of neisseria gonorrhoeae. A provided specific primer for the multiple detection of the drug resistance sites of the neisseria gonorrhoeae selects drug-resistance-related genes of two drug combinations (ceftriaxone and azithromycin) as target genes for detection, and includes penA, ponA, porB, mtrR, and 23S rRNA. Based on high resolution melting curve analysis technique, the DNA demulsification process is monitored in real time through high resolution melting of PCR products, the mutation condition of the genes is analyzed according to the characteristic change of a melting curve, and thus a basis is provided for determining the drug-resistant condition of the neisseria gonorrhoeae.
Owner:USTAR BIOTECHNOLOGIES (HANGZHOU) CO LTD

Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker

The invention provides a fluorescent molecular marker of a rice waxy gene Wx and application of the fluorescent molecular marker. Primers of the fluorescent molecular marker comprise an RWx-FG primer,an RWx-FT primer, an RWx-R primer, a first universal primer and a second universal primer, wherein the sequence of the RWx-FG primer is shown in SEQ ID NO:1, the sequence of the RWx-FT primer is shown in SEQ ID NO:2, the sequence of the RWx-R primer is shown in SEQ ID NO:3, the sequence of the first universal primer is shown in SEQ ID NO:4, and the sequence of the second universal primer is shownin SEQ ID NO:5. According to the technical scheme, a test sample is subjected to PCR amplification only once, no electrophoresis detection is required, and amplification data is obtained by directlyusing a fluorescence scanner on an original plate; the operation is simple, convenient and rapid, the cost is low, the result is accurate, and the real closed-tube operation is achieved.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI

Primer pair, probe and kit for detecting human VDR, GC, LRP5 and SLC30A8 gene polymorphism

The invention discloses a primer pair, a probe and a kit for detecting human VDR, GC, LRP5 and SLC30A8 gene polymorphism, and in particular a primer pair, a probe and a kit for detecting the gene polymorphism with the adoption of a multiple-asymmetrical fluorescent PCR probe melting curve method, wherein nucleotide sequences of upstream primers and downstream primers, which are used for amplifyinghuman VDR, GC, LRP5 and SLC30A8 genes, are sequentially shown SEQ ID NO:1-SEQ ID NO:8. The detection kit provided by the invention, which is free from complex experimental operations, is rapid and convenient; through complete closed-tube operations, cross pollution is prevented; and the kit is low in cost, high in sensitivity and strong in specificity, and the kit is applicable to large-scale promotion and application.
Owner:深圳鼎新融合科技有限公司

Aedes albopictus and aedes aegypti CYTB gene identification kit based on high-resolution melting curve and identification method thereof

The invention relates to the field of species identification, and provides an aedes albopictus and aedes aegypti CYTB gene identification kit based on a high-resolution melting curve and an identification method thereof. The aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve is characterized in that universal primers are designed according toaedes albopictus and aedes aegypti CYTB gene sequences, and an optimized high-resolution melting curve reaction system is adopted to identify aedes albopictus and aedes aegypti of various forms suchas imagoes, ova, larvae and pupae. By the adoption of the aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve and the identification method thereof, aedes albopictus and aedes aegypti can be identified; operation is easy, the speed is high, no PCR products need post-treatment, the difference of a single base can be detected, and closed-tube operation is indeed achieved.
Owner:山东国际旅行卫生保健中心

Method for identifying four fusaria

The invention provides a method for identifying four fusaria, and belongs to the technical field of analysis of high-resolution melting curves. According to the method, a pair of specific primers areadopted, fusarium proliferatum, fusarium oxysporum, fusarium semitectum and fusarium solani are identified based on a real-time fluorescence PCR (RT-PCR) melting curve, and the sequence of the specific primers is shown in SEQ ID NO.1-2. The method is high in sensitivity, good in specificity and high in detection speed and can be used for identification of fusarium strains in the aspects of clinical diagnosis, agricultural production, food safety and the like, and therefore a reliable basis is provided for monitoring of fusaria in the aspects of infection treatment, agricultural production andfood safety.
Owner:西安博睿康宁生物科技有限公司

Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR

The invention discloses a kit and a detection method for detecting endogenus component from a bear by means of fluorescence PCR. The kit comprises a forward primer 5'-CGCTAATCTTCTCTATCCTA-3', a reverse primer 5'-CTGTCCGATAATGGTGAA-3', and a probe 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT (Eclipse)-3'. The detection method comprises the steps: extracting sample DNA; performing fluorescence PCR amplification on the sample DNA; performing HRM analysis on the amplified product and determining a result. According to the kit and the detection method, a detection process is simplified, and other analyzing devices are not needed for the PCR product in a whole process, so that stopped pipe operation is realized, and crossing contamination is avoided. A good method for accurately and quickly detecting the endogenus component from the bear can be supplied instead of a traditional method for recognizing a bear gall by sense organs, and has a good application prospect.
Owner:蔡先全

Method for detecting Enterobacter sakazakii by employing non-labeled fluorescence PCR technology and HRM analysis technology

The invention discloses a method for detecting Enterobacter sakazakii by employing non-labeled fluorescence PCR technology and HRM analysis technology. The method is characterized by comprising the following steps: A, designing a primer pair according to the OmpA gene of Enterobacter sakazakii; B, after sample DNA is extracted, carrying out non-labeled fluorescence PCR amplification by using the designed primer pair; and C, carrying out HRM typing analysis on PCR amplification products by using a fluorescence ration PCR instrument with an HRM module so as to determine the genotype of Enterobacter sakazakii. The objective of the invention is as follows: to overcome disadvantages in the prior art, the method for detecting Enterobacter sakazakii by employing non-labeled fluorescence PCR technology and HRM analysis technology with the advantages of simple and rapid operation, accurate detection results and low usage cost is provided.
Owner:广州生凌医疗科技有限公司

Probe and method for detecting polymorphism of TREM2 gene

The invention discloses a method for detecting polymorphism of a TREM2 gene, wherein the method includes the following steps: determining a mutation site of the TREM2 gene; designing and synthesizinga probe and primers according to the mutation site; mixing the detected TREM2 target gene, the probe, the primers and enzymes, carrying out fluorescence quantitative PCR, and monitoring a fluorescencesignal; and calculating the Tm value displayed by hybrid peaks, and judging the type of the TREM2 gene according to the Tm value. The invention also discloses the probe for detecting the polymorphismof the TREM2 gene, and the probe has the nucleotide sequence including SEQ ID NO.3. The invention provides the probe and method for simple operation and rapid detection of the polymorphism of the TREM2 gene.
Owner:上海利康精准医疗技术有限公司

Primer, kit and method for detecting transgenic maize NOS terminator

The invention discloses a primer, a kit and a method for detecting a transgenic maize NOS terminator. The sequence of the Zein F of the primer is TTATGCTCCTTGGTCTTT. The sequence of the Zein R of the primer is GTAATAGGGCTGATGATTG. The sequence of the NOS F of the primer is TAATTGCGGGACTCTAAT. The sequence of the NOS R of the primer is AATCCTGTTGCCGGTCTT. The kit comprises 10 microliters of HRM reaction premix liquid, 0.2-3.4 microliters of the primer and 1 microliter of DNA (deoxyribonucleic acid) template, and water is added to reach 20 microliters. The detecting method includes: extracting a sample DNA; using the kit to perform PCR (polymerase chain reaction) amplification on the sample DNA; performing high-resolution melting curve analysis on the products after the amplification, and combining an amplification curve to judge results. The primer, the kit and the method are used for detecting maize Zein genes, namely endogenuous reference genes and a maize transcription terminator NOS, the kit is reasonable in component and proportion, convenient to use, and fast and accurate in detection, and the method is simple and fast to operate, low in cost and accurate in detecting result.
Owner:蔡先全

Kit for detecting eight staphylococcus aureus drug-resistance genes and detection method

The invention discloses a kit for detecting eight staphylococcus aureus drug-resistance genes and a detection method. The kit is characterized in that a reaction system in a non-marked fluorescence PCR amplification process consists of an HRM reaction pre-mixing liquid, a dNTPs mixed liquid, Tag polymerase, an upstream primer, a downstream primer, fluorochrome, a DNA template and water. The detection method is characterized by comprising the following steps: A, designing a primer pair according to the eight staphylococcus aureus drug resistance genes; B, extracting sample DNA, and performing fluorescence PCR amplification according to the designed primer pair; and C, performing HRM analysis on a PCR amplification product by using a fluorogenic quantitative PCR with an HRM module, confirming the Tm value of the amplification product, and judging the result. The invention aims at providing a method which is simple, convenient and rapid to operate and low in cost and is used for detecting eight drug resistance genes by using multi-fluorescence PCR, and the detection result is accurate.
Owner:江苏睿玻生物科技有限公司

Method for screening mutation of red transcription factor EKLF gene and application thereof

The invention belongs to the field of biological medicine, and particularly relates to a method for screening mutation of a red transcription factor EKLF gene and application thereof. The method is characterized in that an amplification primer is designed according to an EKLF gene sequence, and screening is conducted on unknown mutation of the EKLF gene in a sample by means of an optimized high-resolution melting curve reaction system. The detection method is easy to operate, high in speed and high in flux, a PCR product does not need to be subjected to aftertreatment, the difference of single basic groups can be detected, closed-tube operation is truly achieved, and the method has wide clinical application prospects.
Owner:GUANGDONG WOMEN & CHILDREN HOSPITAL

Primer, reagent box and method for detecting transgenic soybean MON87708

The invention discloses primer, a reagent box and a method for detecting transgenic soybean MON87708. The primer comprises LectinF: TCTGTCGTTGTGGTGCTA, LectinR: CTGCGAGATTTGCTATGT, MON87708F: GTCAAGGAGGACAAGGTCG and MON87708R: CCAATGCCATAATACTCAAAC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. In the primer, the reagent box and the method for detecting transgenic soybean MON877088 and endogenous genes Lectin, the reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.
Owner:蔡先全

Primer, reagent box and method for detecting staphylococcus aureus and mecA

The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.
Owner:蔡先全

Method for detecting hereditary thoracic aortic aneurysm and dissecting associated gene mutation

The invention relates to a method for detecting hereditary thoracic aortic aneurysm and dissecting associated gene mutation, in particular to a method for detecting TGFBR1, TGFBR2 and ACTA2 gene mutations by using multiple oligonucleotide connection detection probes and liquid-phase chips. The method comprises the following steps: (a) designing and manufacturing a group of multiple oligonucleotide connection detection probes for 13 mutation sites of the TGFBR1, TGFBR2 and ACTA2 genes, wherein the multiple oligonucleotide connection detection probes have the nucleotide sequences of SEQ ID No. 1 and SEQ ID No. 26; (b) carrying out DNA (deoxyribonucleic acid) sample denaturation, probe hybridization and ligation reaction; (c) carrying out PCR (polymerase chain reaction) amplification to the sequences of the multiple oligonucleotide connection detection probes by using universal primers; and (d) detecting the products of amplification by using the liquid-phase chips. The technology can realize the single-tube reaction detection to dozens of mutation sites, is high in throughput and low in cost, and is easy to operate.
Owner:姬云

Primer and kit for quickly detecting transgenic maize PAT

The invention specifically discloses a primer and a kit for quickly detecting transgenic maize PAT. The primer comprises an inner reference primer pair and an exogenous gene primer pair; the primer pair in the kit comprises the inner reference primer pair and the exogenous gene primer pair; a reaction system component in the kit comprises HRM reaction premixed solution, the inner reference primer pair, the exogenous gene primer pair, a reaction template and deionized water. The primer is reasonable in component and proportion, is quick and convenient in detection, is high in accuracy and is suitable for fluorescence PCR detection for Zein gene and PAT gene of transgenic sorghum. The detection sensitivity of the primer is higher and can reach up to 0.1%; the stability is higher; the logarithm value of template concentration and the Cp value have an excellent linear relation: R2 more than or equal to 0.96; the accuracy of the detection result of the primer is as high as about 98%; the operation step is simplified according to the invention, so that the detection period is shortened, the quantitative analysis can be realized and the application value is higher.
Owner:SHENZHEN HUICHUANG UNITED AUTOMATION CONTROL CO LTD

Method for detecting vibrio parahemolyticus through combination of unlabelled fluorescent PCR (Polymerase Chain Reaction) and HRMA (High Resolution Melting Analysis)

The invention discloses a method for detecting vibrio parahemolyticus through combination of unlabelled fluorescent PCR and HRMA, which is characterized by including the following steps: firstly, a primer pair is designed according to a TLH (thermolabile hemolysin) gene of the vibrio parahemolyticus; secondly, after DNA (Deoxyribonucleic acid) samples are extracted, unlabelled fluorescent PCR amplification is performed by utilizing the designed primer pair; and thirdly, an amplification curve of a PCR amplification product and the HRMA are analyzed by application software. The purposes of the method are to overcome defects of the prior art and provide a method, which is simple, convenient and fast to operate, accurate in detection result and low in usage cost, for detecting the vibrio parahemolyticus through the combination of the unlabelled fluorescent PCR and the HRMA.
Owner:邳州市博睿投资管理有限公司

Probe, primer and kit for detecting AK4 gene polymorphism

The invention discloses a probe, primer and kit for detecting AK4 gene polymorphism. The sequence of the probe is shown as SEQ ID NO.: 1, SEQ ID NO.: 4 or SEQ ID NO.: 7, or the two ends of each of the sequences of SEQ ID NO.: 1, SEQ ID NO.: 4 and SEQ ID NO.: 7 are subjected to group modification. The probe, primer and kit for detecting the AK4 gene polymorphism have the advantages of high sensitivity, good specificity, rapidness, high-throughput detection and the like during detection of AK4 gene polymorphism.
Owner:上海利康精准医疗技术有限公司 +1

A HRM detection method and primers for rapid identification of mouse encephalomyelitis virus and rat Theileria virus

The invention discloses an HRM detection method and primer for quick identification of a mouse encephalomyelitis virus and a rat Theiler virus. According to the method, operation is easy, and fluorescence saturable dye only needs to be added before PCR reaction; detection is quick, flux is high, the whole operation process only lasts for 3 h, and PCR product detection of a 72 / 100 or 96 / 384 pore plate can be achieved through one-time preparation conducted with an instrument; cost is low, specific probes are not needed, and the cost of saturable dye for each sample is 1.6 yuan; accuracy is high, specificity and repeatability are high, accurate, quick and high-flux analysis can be achieved, and the HRM detection method and primer are suitable for being applied and popularized in clinical practice.
Owner:GUANGDONG LAB ANIMALS MONITORING INST

Kit and method for identifying ND5 genes of culex pipiens pallens and culex fatigans based on high-resolution melting curve

ActiveCN108192986AHigh sensitivityStrong specificityMicrobiological testing/measurementDNA/RNA fragmentationCulex pipiens molestusCulex pipiens pallens
The invention relates to the field of species identification, and discloses a kit for identifying culex pipiens pallens and culex fatigans based on a high-resolution melting curve. The kit is characterized in that universal primers are designed according to the sequences of ND5 genes of the culex pipiens pallens and culex fatigans, and various forms such as bugs, eggs, larvae and pupae of the culex pipiens pallens and culex fatigans are identified through an optimized high-resolution melting curve reaction system. The culex pipiens pallens and culex fatigans can be identified, operation is simple, speed is high, no postprocessing is required by PCR products, the difference of a single basic group can be detected, and closed-tube operation is truly realized.
Owner:山东国际旅行卫生保健中心

Kit for detecting genotypes of human mitochondrial ND3 gene at 10191rst locus based on HRM method and method of kit

The present invention discloses a kit for detecting genotypes of human mitochondrial ND3 gene at a 10191rst locus based on a HRM method. The kit comprises PCR primers for amplifying the mitochondrialND3 gene at the 10191rst locus; and the PCR primers comprise an upstream primer F: 5'-AACTCAACGGCTACATAG-3'; and a downstream primer R: 5'-TTTATGGAGAAAGGGACG-3'. The HRM technology is not limited by loci of bases or types of the bases, does not need to synthesize expensive probes, only needs to dissolve a reaction product in one step after a reaction is completed, then uses an instrument to analyze a dissolution curve and completes genotyping and scanning of mutation sites.
Owner:THE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV +1

Kit and detection method for detecting eight drug-resistant genes of Staphylococcus aureus

The invention discloses a kit for detecting eight staphylococcus aureus drug-resistance genes and a detection method. The kit is characterized in that a reaction system in a non-marked fluorescence PCR amplification process consists of an HRM reaction pre-mixing liquid, a dNTPs mixed liquid, Tag polymerase, an upstream primer, a downstream primer, fluorochrome, a DNA template and water. The detection method is characterized by comprising the following steps: A, designing a primer pair according to the eight staphylococcus aureus drug resistance genes; B, extracting sample DNA, and performing fluorescence PCR amplification according to the designed primer pair; and C, performing HRM analysis on a PCR amplification product by using a fluorogenic quantitative PCR with an HRM module, confirming the Tm value of the amplification product, and judging the result. The invention aims at providing a method which is simple, convenient and rapid to operate and low in cost and is used for detecting eight drug resistance genes by using multi-fluorescence PCR, and the detection result is accurate.
Owner:江苏睿玻生物科技有限公司

A microfluidic chip and detection device suitable for PCR or HRM detection and analysis

The invention discloses a micro-fluidic chip and a detecting device suitable for PCR (polymerase chain reaction) or HRM (high resolution melting) detection analysis. A micro pipeline and an array reaction chamber base plate form a combined mould, a micro-fluidic base chip is generated by virtue of an injection molding method, the micro-fluidic chip is formed by virtue of plasma cleaning and glass bonding; a rotary rod with a handle and a duct is transversely embedded in an outward channel center of the chip to form a rotary valve; the handle rotates to disconnect the duct to control on-off and sealing of multi-reaction-chamber sampling, so that physical isolation between reaction chambers is realized, the sealing performance is good, and cross contamination does not exist, and thus, a plurality of samples can be detected at the same time. The micro-fluidic chip disclosed by the invention not only can be used for independent PCR detection or HRM detection, but also can be used for performing PCR detection and then performing HRM detection without any change in a combined manner, so that the multi-functionalization of detection is realized.
Owner:HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI +1

Method for identifying five species of Trichosporon spp. on basis of high-resolution melting curve

The invention provides a method for identifying five species of Trichosporon spp. on the basis of a high-resolution melting curve. The five species of Trichosporon spp. comprise Trichosporon asahii, Trichosporon ink in, Trichosporon dermatis, Trichosporon montevideense and Trichosporon dohaense. According to the method, a specific primer pair capable of identifying the five species of Trichosporon spp. simultaneously is utilized, to-be-detected sample DNA is utilized as a template, a high-resolution melting curve reaction system is established, a high-resolution melting curve reaction program is adopted, fluorescence intensity is continuously detected, and a melting curve chart with first-order negative derivatives of fluorescence signals to temperatures as longitudinal coordinates and temperatures as horizontal coordinates is obtained. According to the method, follow-up PCR product electrophoresis detection and sequencing are not needed, the operating process is simplified, the detection efficiency is improved, and sensitivity and specificity are higher.
Owner:WUHAN UNIV OF SCI & TECH

A primer for identifying grass carp reovirus type Ⅱ vaccine strain and wild strain, a kit containing it, and a diagnostic detection method

The invention provides a high-resolution-melting (HRM)-based grass carp reovirus (GCRV) II type vaccine strain and wild strain differential diagnosis and detection primer. The differential diagnosis and detection primer comprises the following pair of primers: HRM-II-F: 5'CACCGGAGTTAAACTTCATCGC-3'(SEQ ID NO: 1) and HRM-II-R: 5'CCTGTGGCAGACCGGCAGATAA 3'(SEQ ID NO: 2), and is obtained through designing according to a GCRV II type vaccine strain and a known II type wild strain S2 gene 5' end and 3' end conserved domains, one or more stationary base mutation sites exist or exists between the vaccine strain and a wild strain amplified product, the mutation sites are unique for the vaccine strain, identification and analysis of HRM to the GCRV II type vaccine strain and the wild strain are achieved, moreover, a corresponding detection agent and a corresponding detection method are designed according to the HRM-based GCRV II type vaccine strain and wild strain differential diagnosis and detection primer, and the practicability of the technology is improved.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More