HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus
A technology of Muscovy duck parvovirus and goose parvovirus, applied in the field of molecular biology, can solve the problems of increasing the cost of identification, operational complexity, time-consuming and laborious, etc., and achieve the goal of reducing identification cost, avoiding pollution, and high-throughput detection speed Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Establishment of the HRM Rapid Identification Kit for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV):
[0048] 1. Primer design: A pair of primers were designed with the VP3 genes of MDPV-FM and GPV-B (GenBank accession numbers U22967 and U25749, respectively) as the target genes. The sequences are as follows:
[0049] MGV-P1: ATGGCAGAGGGAGGAAGC (SEQ ID NO: 1);
[0050] MGV-P2: TGCGTCGTGACTTCTTTAACTTGC (SEQ ID NO: 2).
[0051] 2. PCR reaction solution: Taq DNA polymerase; 5×PCR reaction buffer; 2.5 mM dNTP; fluorescent saturating dye;
[0052] 3. The positive control is the positive plasmid of MDPV and GPV, and the negative control is ddH 2 O.
[0053] Wherein the preparation method of the positive plasmid is as follows :
[0054] The VP3 gene (SEQ ID NO:3) of MDPV and the VP3 gene (SEQ ID NO:4) of GPV were respectively connected to the pMD-18T vector with the kit of TaKaRa Company, and the positive clones were screened by ampicillin screenin...
Embodiment 2
[0055] Example 2 Establishment of HRM Rapid Identification Method for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV)
[0056] The method for rapidly identifying Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) using the kit of Example 1 comprises the following steps:
[0057] 1. The positive plasmids of MDPV and GPV prepared in Example 1 were tested for DNA concentration, so that the initial template concentration of PCR was relatively consistent.
[0058] 2. PCR amplification reaction
[0059](1) PCR reaction system: 5×Q5 Reaction buffer 2μl, 2.5 mM dNTP 0.8μl, MGV-P1 (10μM) 0.5μl, MGV-P1 (10μM) 0.5μl, Q5 High-Fidelity DNA Polymerase 0.1μl, plasmid DNA 0.5 μl, LC Green 0.5μl, make up to 10μl with ultrapure water; mix the prepared reaction tube, centrifuge and put it on the machine.
[0060] (2) The PCR reaction procedure is as follows:
[0061] Pre-denaturation at 98°C for 30s;
[0062] Denaturation at 98°C for 10s, annealing at 55°C for 20s, extensi...
Embodiment 3
[0067] Example 3 Application Evaluation of HRM Rapid Identification Method for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV)
[0068] 1. Extraction of genomic DNA from the sample to be tested: use the kit MiniBEST Viral RNA / DNA Extraction Kit Ver.4.0 to extract the genomic DNA of MDPV and GPV in the sample. The samples of the present invention are virus allantoic fluid and cell supernatant.
[0069] 2. Ordinary PCR amplification reaction:
[0070] (1) PCR reaction system: 25 μl Reaction system: 5×Q5 Reaction buffer 5 μl, 2.5 mM dNTP 2 μl, MGV-P1 (10 μM) 1.25 μl, MGV-P1 (10 μM) 1.25 μl, Q5 High-Fidelity DNA Polymerase 0.25 μl, 1 μl of the sample DNA to be tested was made up to 25 μl with ultrapure water; the prepared reaction tube was mixed and centrifuged before loading on the machine.
[0071] (2) PCR reaction procedure:
[0072] Pre-denaturation at 98°C for 30s;
[0073] Denaturation at 98°C for 10s, annealing at 55°C for 20s, extension at 72°C for 20s; cyc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 