Supercharge Your Innovation With Domain-Expert AI Agents!

Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR

A technology of source components and detection methods, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as undetectable fluorescent signals, avoid cross-contamination, reasonable components and ratios, and results. accurate effect

Inactive Publication Date: 2015-04-29
蔡先全
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At this time, the 5-terminal fluorescent group absorbs energy and transfers the energy to the adjacent 3'-terminal fluorescence quencher group, and FRET occurs, so the fluorescent signal emitted by the 5-terminal fluorescent group of the probe cannot be detected under normal circumstances.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR
  • Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR
  • Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The kit for detecting bear-derived components by fluorescent PCR of the present invention comprises:

[0046] Upstream primer: 5'-CGCTAATCTTCCTCTATCCTA-3'

[0047] Downstream primer: 5'-CTGTCCGATAATGGTGAA-3'

[0048] Probe: 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT(Eclipse)-3'.

Embodiment 2

[0050] The 20 μL reaction system prepared in the kit of the present invention consists of the following components:

[0051]

[0052] The upstream primer: 5'-CGCTAATCTTCCTCTATCCTA-3'

[0053] The downstream primer: 5'-CTGTCCGATAATGGTGAA-3'

[0054] The probe: 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT(Eclipse)-3'.

[0055] The 2.5mM dNTPs mixed solution is composed of 2.5mM dATP, 2.5mM dCTP, 2.5mM dTTP, and 2.5mM dGTP.

Embodiment 3

[0057] Fluorescent PCR of the present invention detects the method for bear-derived component, comprises the following steps:

[0058] A. Extract sample DNA;

[0059] B. Carry out fluorescent PCR amplification to the sample DNA in step A, wherein the reaction system consists of the following components:

[0060]

[0061] The 2.5mM dNTPs mixed solution is composed of 2.5mM dATP, 2.5mM dCTP, 2.5mM dTTP, and 2.5mM dGTP.

[0062] Described fluorescent PCR amplification is carried out according to the following steps:

[0063] (1) Pre-denaturation at 92°C to 96°C for 30s;

[0064] (2) Denaturation at 92°C to 96°C for 5s to 10s, annealing at 55°C to 63°C for 20s to 40s, for a total of 35 to 45 cycles.

[0065] C. The amplified product is subjected to HRM analysis and the result is judged.

[0066] Wherein, the HRM analysis of the PCR amplification product is carried out according to the following steps:

[0067] (1) 92℃~96℃ denaturation for 1min;

[0068] (2) Refolding at 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and a detection method for detecting endogenus component from a bear by means of fluorescence PCR. The kit comprises a forward primer 5'-CGCTAATCTTCTCTATCCTA-3', a reverse primer 5'-CTGTCCGATAATGGTGAA-3', and a probe 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT (Eclipse)-3'. The detection method comprises the steps: extracting sample DNA; performing fluorescence PCR amplification on the sample DNA; performing HRM analysis on the amplified product and determining a result. According to the kit and the detection method, a detection process is simplified, and other analyzing devices are not needed for the PCR product in a whole process, so that stopped pipe operation is realized, and crossing contamination is avoided. A good method for accurately and quickly detecting the endogenus component from the bear can be supplied instead of a traditional method for recognizing a bear gall by sense organs, and has a good application prospect.

Description

technical field [0001] The invention relates to a kit and a detection method for detecting bear-derived components by fluorescence PCR based on Taqman technology. The kit and the detection method of the invention have good specificity and high sensitivity. Background technique [0002] Bear bile has the effects of clearing away heat, calming the liver, and nourishing the liver, and has great medicinal and economic value. Some experts pointed out that artificially synthesized ursodeoxycholic acid is only one of more than 40 main components contained in natural bear bile. Therefore, similarity does not mean that it can be replaced. In recent years, unscrupulous traders have used other animal sources (pig gall, ox gall, and sheep gall) to pass off as bear bile, which not only affects the quality of pharmaceutical raw materials, but also may cause serious drug quality problems, which has aroused concern from all walks of life. [0003] The traditional method mainly uses the sur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q1/6844C12Q2561/101
Inventor 蔡先全邱德义岳巧云杨晓荣邱霞张磊赵美转吉宇恒
Owner 蔡先全
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More