Kit and detection method for detecting endogenus component from bear by means of fluorescence PCR
A technology of source components and detection methods, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as undetectable fluorescent signals, avoid cross-contamination, reasonable components and ratios, and results. accurate effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] The kit for detecting bear-derived components by fluorescent PCR of the present invention comprises:
[0046] Upstream primer: 5'-CGCTAATCTTCCTCTATCCTA-3'
[0047] Downstream primer: 5'-CTGTCCGATAATGGTGAA-3'
[0048] Probe: 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT(Eclipse)-3'.
Embodiment 2
[0050] The 20 μL reaction system prepared in the kit of the present invention consists of the following components:
[0051]
[0052] The upstream primer: 5'-CGCTAATCTTCCTCTATCCTA-3'
[0053] The downstream primer: 5'-CTGTCCGATAATGGTGAA-3'
[0054] The probe: 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT(Eclipse)-3'.
[0055] The 2.5mM dNTPs mixed solution is composed of 2.5mM dATP, 2.5mM dCTP, 2.5mM dTTP, and 2.5mM dGTP.
Embodiment 3
[0057] Fluorescent PCR of the present invention detects the method for bear-derived component, comprises the following steps:
[0058] A. Extract sample DNA;
[0059] B. Carry out fluorescent PCR amplification to the sample DNA in step A, wherein the reaction system consists of the following components:
[0060]
[0061] The 2.5mM dNTPs mixed solution is composed of 2.5mM dATP, 2.5mM dCTP, 2.5mM dTTP, and 2.5mM dGTP.
[0062] Described fluorescent PCR amplification is carried out according to the following steps:
[0063] (1) Pre-denaturation at 92°C to 96°C for 30s;
[0064] (2) Denaturation at 92°C to 96°C for 5s to 10s, annealing at 55°C to 63°C for 20s to 40s, for a total of 35 to 45 cycles.
[0065] C. The amplified product is subjected to HRM analysis and the result is judged.
[0066] Wherein, the HRM analysis of the PCR amplification product is carried out according to the following steps:
[0067] (1) 92℃~96℃ denaturation for 1min;
[0068] (2) Refolding at 4...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com