Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A HRM detection method and primers for rapid identification of mouse encephalomyelitis virus and rat Theileria virus

An encephalomyelitis virus, rat Taylor virus technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragment, etc. problem, to achieve the effect of fast detection speed, good repeatability, and high throughput of detection speed

Active Publication Date: 2019-05-07
GUANGDONG LAB ANIMALS MONITORING INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ordinary PCR method needs to open the cover to analyze the product by gel electrophoresis, the operation method is not simple enough, and it is easy to produce aerosol pollution, resulting in false positives
Fluorescent quantitative PCR detection method requires the design of fluorescently labeled probes, which is relatively expensive, which limits the popularization and application of this method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A HRM detection method and primers for rapid identification of mouse encephalomyelitis virus and rat Theileria virus
  • A HRM detection method and primers for rapid identification of mouse encephalomyelitis virus and rat Theileria virus
  • A HRM detection method and primers for rapid identification of mouse encephalomyelitis virus and rat Theileria virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The design of embodiment 1 specific primer

[0059] The present invention designs the primers that can detect TMEV and RTV simultaneously; And a large amount of experimental screenings are done to the designed primers, and a pair of strong specificity primers are screened out, and its nucleotide sequence is as follows:

[0060] Upstream primer P1: ATTTGAAAGCAATGGTTAGC (SEQ ID NO: 1);

[0061] Downstream primer P2: GATCGAGAGGATGTTCATCTAA (SEQ ID NO: 2).

Embodiment 2

[0062] The PCR-HRM analysis of embodiment 2 plasmid standards

[0063] (1) Preparation of TMEV and RTV plasmid standards:

[0064] The RNAs of mouse encephalomyelitis virus and rat Theilera virus were extracted respectively, and primers P1 and P2 were used for RT-PCR amplification with PrimeScript One Step RT-PCR Kit Ver.2 kit (Takara Company):

[0065] The reaction system is: Enzyme Mix 2 μl, 2×RT-PCR Buffer 25 μl, upstream primer P1 (10 μM ) 2.5 μl, downstream primer P2 (10 μM) 2.5 μl, RNA 5 μl, add RNase Free ddH 2 0 to 50 μl.

[0066] The reaction conditions were: reverse transcription at 50°C for 30 min, 94°C for 2 min, a cycle of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec, a total of 35 cycles, and a final extension at 72°C for 7 min.

[0067] The PCR products were subjected to 2% agarose gel electrophoresis, and the target fragments were recovered using a gel recovery kit (Tiangen Company) and then cloned into the pGEM-T Easy vector (Promega Company) to obt...

Embodiment 3

[0080] Example 3 PCR-HRM detection of clinical samples

[0081] (1) Extraction of RNA in the sample to be tested:

[0082] The samples to be tested in the present invention are the contents of spleen and cecum of rats collected in Guangdong area, and TMEV and RTV genomic RNA in the samples are extracted with Trizol reagent (Invitrogen Company).

[0083] (2) One-step RT-PCR amplification:

[0084] The extracted genomic RNA was amplified by one-step RT-PCR using PrimeScript one step RT-PCR Kit Ver.2 kit.

[0085] The reaction system is as follows:

[0086]

[0087] The one-step RT-PCR amplification reaction procedure is as follows:

[0088] 50°C for 30 min; 94°C pre-denaturation for 3 min; 94°C denaturation for 20 sec, 55°C annealing for 20 sec, 72°C extension for 20 sec, 40 cycles; 72°C final extension for 5 min; the melting rate set for HRM analysis was 0.3°C / sec.

[0089] (3) Two-step amplification:

[0090] cDNA was obtained by reverse transcription using the RNA ext...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HRM detection method and primer for quick identification of a mouse encephalomyelitis virus and a rat Theiler virus. According to the method, operation is easy, and fluorescence saturable dye only needs to be added before PCR reaction; detection is quick, flux is high, the whole operation process only lasts for 3 h, and PCR product detection of a 72 / 100 or 96 / 384 pore plate can be achieved through one-time preparation conducted with an instrument; cost is low, specific probes are not needed, and the cost of saturable dye for each sample is 1.6 yuan; accuracy is high, specificity and repeatability are high, accurate, quick and high-flux analysis can be achieved, and the HRM detection method and primer are suitable for being applied and popularized in clinical practice.

Description

technical field [0001] The invention belongs to the field of virus detection, and in particular relates to a HRM detection method and primers for rapidly distinguishing mouse encephalomyelitis virus and rat Theileria virus. Background technique [0002] Mouse encephalomyelitis virus (Theiler's murine encephalomyelitis virus, TMEV) belongs to Picornaviridae, Cardiovirus ( Cardiovirus ). The nucleic acid is a negative-strand single-stranded RNA with a genome size of about 8100bp. Mouse encephalomyelitis virus is widespread in the mouse population, with an infection rate of 8% to 35%. Most of the viruses are recessive infections, mainly infecting the central nervous system of mice, leading to encephalomyelitis, clinical manifestations of hind limb paralysis, and occasionally spreading to the forelimb. In recent years, studies have found that rats can also be naturally infected with TMEV virus. Inoculation of TMEV virus in the brain of rat suckling mice can lead to symptoms s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/6844C12Q1/701C12Q2531/113C12Q2527/107C12Q2545/113
Inventor 袁文郭鹏举饶丹王静黄碧洪练月晓张钰黄韧
Owner GUANGDONG LAB ANIMALS MONITORING INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com