Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A primer for identifying grass carp reovirus type Ⅱ vaccine strain and wild strain, a kit containing it, and a diagnostic detection method

A reovirus and differential diagnosis technology, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microbial determination/examination, can solve the problems of prevention and control of grass carp hemorrhagic disease, lack of differential diagnosis methods, etc. Good specificity, closed-tube operation, and good repeatability

Active Publication Date: 2020-09-18
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the only commercial grass carp haemorrhagic disease vaccine approved by regulations is a live attenuated vaccine. However, in the actual application process, due to the lack of effective differential diagnosis methods, once grass carp is infected or infected, it is impossible to distinguish whether it is immune to the vaccine strain or the wild strain. Caused by infection, causing great trouble to the prevention and control of grass carp haemorrhagic disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer for identifying grass carp reovirus type Ⅱ vaccine strain and wild strain, a kit containing it, and a diagnostic detection method
  • A primer for identifying grass carp reovirus type Ⅱ vaccine strain and wild strain, a kit containing it, and a diagnostic detection method
  • A primer for identifying grass carp reovirus type Ⅱ vaccine strain and wild strain, a kit containing it, and a diagnostic detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Design and synthesis of specific primers

[0036] The S2 gene sequences of 8 GCRV-Ⅱ wild strains and 908 attenuated vaccine strains obtained from NCBI, including HuNan1307, GD108, 106, 918, HeNan988, HeNan794, HZ08, and 109, were compared and analyzed using Oligo 6.0 software, respectively. Primers were designed according to the conserved regions of the 5' and 3' ends of the S2 gene of the grass carp reovirus type Ⅱ vaccine strain and the known type Ⅱ wild strain. base mutation sites. The sequence of the upstream primer HRM-Ⅱ-F is: 5'-CACCGGAGTTAAACTTCATCGC-3', the sequence of the downstream primer HRM-Ⅱ-R is: 5'-CCTGTGGCAGACCGGCAGATAA-3', and the expected length of the PCR amplification product is 233bp.

Embodiment 2

[0037] Example 2: RNA extraction and cDNA preparation

[0038] According to the instructions of the Trizol kit (purchased from Invitrogen, product number: 15596-026) or according to the instructions of the Qiagen RNA extraction kit (purchased from Qiagen, product number: 74104), RNA was extracted from the visceral tissues of fish infected with the corresponding virus. , as a template for RT-PCR reactions. The main steps of Trizol extraction of total RNA are as follows: take the tissue sample and add 500 μl Trizol reagent, mix well and let it stand for 5 minutes, add 400 μl chloroform, shake and mix for 1 minute, centrifuge at 12000 rpm at 4°C for 15 minutes, take the supernatant and add an equal volume of isopropyl Alcohol, mix upside down, place at 4°C for 15min, centrifuge at 12,000rpm at 4°C for 15min, discard the supernatant, wash the pellet with 70% ethanol, centrifuge at 12,000rpm at 4°C for 5min, and resuspend the pellet with 30μl RNAse-free water. The RNA was then rev...

Embodiment 3

[0039] Embodiment 3: GCRVⅡ virus PCR detection

[0040] GSB cells infected by attenuated vaccine strain JX0902 and wild strains HuNan1307, HZ08, GD1607 and GX1407 were detected by PCR method. The PCR system is: cDNA 1.0 μL, upstream primer HRM-Ⅱ-F and downstream primer HRM-Ⅱ-R 0.5 μL, 2.5 mM dNTP 2.0 μL, 10×PCR buffer 1.0 μL, Taq enzyme 0.5 μL, ultrapure water Add to 10 μL. Reaction program: 5min at 95°C; 30s at 95°C, 30s at 55°C, 30s at 72°C; 10min at 72°C; end the reaction at 4°C. Prepare 10g / L agarose electrophoresis gel with agarose and electrophoresis buffer for electrophoresis. After electrophoresis, the gel imaging system was used to observe and collect photos of the electrophoresis gel. The results showed that no matter in the GSB cell samples infected by the attenuated vaccine strain or the wild strain, the band with the same position and a size of about 233bp could be obtained after amplification, which was consistent with the expected result (see figure 1 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a high-resolution-melting (HRM)-based grass carp reovirus (GCRV) II type vaccine strain and wild strain differential diagnosis and detection primer. The differential diagnosis and detection primer comprises the following pair of primers: HRM-II-F: 5'CACCGGAGTTAAACTTCATCGC-3'(SEQ ID NO: 1) and HRM-II-R: 5'CCTGTGGCAGACCGGCAGATAA 3'(SEQ ID NO: 2), and is obtained through designing according to a GCRV II type vaccine strain and a known II type wild strain S2 gene 5' end and 3' end conserved domains, one or more stationary base mutation sites exist or exists between the vaccine strain and a wild strain amplified product, the mutation sites are unique for the vaccine strain, identification and analysis of HRM to the GCRV II type vaccine strain and the wild strain are achieved, moreover, a corresponding detection agent and a corresponding detection method are designed according to the HRM-based GCRV II type vaccine strain and wild strain differential diagnosis and detection primer, and the practicability of the technology is improved.

Description

technical field [0001] The invention relates to an in vitro detection method of grass carp reovirus, in particular to a differential diagnosis method and kit for grass carp reovirus type II vaccine strain and virulent strain, and belongs to the field of virus molecular biology. Background technique [0002] Grass carp is one of the most important freshwater aquaculture fishes in my country, which occupies an important position in China's freshwater aquaculture, and its output accounts for more than 20% of my country's total freshwater aquaculture output. In recent years, the scale of grass carp farming in Southeast Asian countries such as Vietnam and Myanmar has also increased, and grass carp farming has gradually become an international trend. However, the frequent occurrence of grass carp viral hemorrhagic disease has greatly reduced its survival rate and caused huge economic losses to farmers. According to incomplete statistics, the economic loss caused by grass carp hemo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2600/156C12Q2531/113C12Q2527/107
Inventor 曾伟伟王庆王英英李莹莹石存斌任燕黄志斌
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com