Primer, reagent box and method for detecting staphylococcus aureus and mecA

A staphylococcus, golden yellow technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc. Reasonable ratio, accurate test results, and shorten the test cycle effect

Inactive Publication Date: 2015-09-09
蔡先全
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For Staphylococcus aureus and mecA-related genes, researchers have carried out conventional PCR and fluorescent PCR method research, but the conventional PCR method requires electrophoresis after PCR amplification, which is not only cumbersome to operate, but also easy to cause pollution, and requires the use of possibly carcinogenic Fluorescent fuel, while the probe fluorescent PCR method is sensitive and accurate, but its detection cost is high, and the validity period of the reagent is short, and it is easy to degrade

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, reagent box and method for detecting staphylococcus aureus and mecA
  • Primer, reagent box and method for detecting staphylococcus aureus and mecA
  • Primer, reagent box and method for detecting staphylococcus aureus and mecA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The primers for detecting the gltB gene of Staphylococcus aureus and the drug-resistant gene mecA by double fluorescent PCR of the present invention include:

[0057] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC

[0058] Downstream primer gltBR: GGATAATGAAGGGAAACC

[0059] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT

[0060] Downstream primer mecAR: TTTATCGGACGTTCAGTC.

Embodiment 2

[0062] A kit for detecting Staphylococcus aureus and mecA of the present invention, wherein the 20 μL reaction system in the kit includes the following components:

[0063]

[0064] in:

[0065] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC

[0066] Downstream primer gltBR: GGATAATGAAGGGAAACC

[0067] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT

[0068] Downstream primer mecAR: TTTATCGGACGTTCAGTC.

Embodiment 3

[0070] The present invention detects the kit used for Staphylococcus aureus and mecA, wherein 20.0 μ L

[0071] The reaction system consists of the following components:

[0072]

[0073] in:

[0074] Wherein the primer sequences are as follows:

[0075] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC

[0076] Downstream primer gltBR: GGATAATGAAGGGAAACC

[0077] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT

[0078] Downstream primer mecAR: TTTATCGGACGTTCAGTC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.

Description

technical field [0001] The present invention relates to a primer for detecting Staphylococcus aureus and the drug-resistant gene mecA; the present invention also relates to a dual fluorescent PCR for detecting Staphylococcus aureus and the methicillin-resistant gene mecA comprising the above-mentioned primers As for the detection kit, the present invention also relates to a method for detecting Staphylococcus aureus and the methicillin-resistant gene mecA by using the above-mentioned kit. Background technique [0002] Staphylococcus is a kind of Gram-positive coccus, which is widely distributed in nature, such as air, water, feed and some foods, and also exists in the body surface, nasopharynx and intestinal tract of humans and animals. Pathogenic staphylococci often cause various suppurative diseases, sepsis or sepsis, and when they contaminate food, they can cause food poisoning. In 1974, Staphylococcus was divided into three types: Staphylococcus aureus, Staphylococcus e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2527/107C12Q2561/101
Inventor 蔡先全柏建山单振菊邱德义萧绮倩李蓉邱霞周思渝
Owner 蔡先全
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap