Primer, reagent box and method for detecting staphylococcus aureus and mecA
A staphylococcus, golden yellow technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc. Reasonable ratio, accurate test results, and shorten the test cycle effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] The primers for detecting the gltB gene of Staphylococcus aureus and the drug-resistant gene mecA by double fluorescent PCR of the present invention include:
[0057] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
[0058] Downstream primer gltBR: GGATAATGAAGGGAAACC
[0059] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT
[0060] Downstream primer mecAR: TTTATCGGACGTTCAGTC.
Embodiment 2
[0062] A kit for detecting Staphylococcus aureus and mecA of the present invention, wherein the 20 μL reaction system in the kit includes the following components:
[0063]
[0064] in:
[0065] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
[0066] Downstream primer gltBR: GGATAATGAAGGGAAACC
[0067] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT
[0068] Downstream primer mecAR: TTTATCGGACGTTCAGTC.
Embodiment 3
[0070] The present invention detects the kit used for Staphylococcus aureus and mecA, wherein 20.0 μ L
[0071] The reaction system consists of the following components:
[0072]
[0073] in:
[0074] Wherein the primer sequences are as follows:
[0075] Upstream primer gltBF: TAATCTTTAGTAGTACCGAAGC
[0076] Downstream primer gltBR: GGATAATGAAGGGAAACC
[0077] Upstream primer mecAF: GTTGTAGTTGTCGGGTTT
[0078] Downstream primer mecAR: TTTATCGGACGTTCAGTC.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
