Bovine-derived component detection kit
A component detection and kit technology, applied in the field of bovine-derived component detection kits, can solve the problem of time-consuming, labor-intensive and high cost, and achieve the effects of improving sensitivity and accuracy, complete inspection objects, and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The bovine-derived component detection kit of this example consists of a primer combination and a membrane chip, and is characterized in that the primer combination is a 4-fold polymerase chain reaction (PCR) primer combination. The 'end was modified with biotin, and the base sequence of each pair of primers 5'-3' is as follows:
[0043] 16S rRNA: forward primer: GACCTCGATGTTGGATCAGGAC
[0044] Reverse primer: GATAGAAACCGACCTGGATTG
[0045] Cattle D-loop: forward primer: AACACAGAATTTGCACCCT
[0046] Reverse primer: ATTAAGCTCGTGATCTAATGGT
[0047] Buffalo D-loop: forward primer: CTGACTTTACACTCTAGCCTA
[0048] Reverse primer: GGATTTGACTTGAATGCACT
[0049] Yak D-loop: forward primer: CTAACAACACACATCCCCAA
[0050] Reverse primer: TTAAGCTCGTGATCTAGTGGA
[0051] The membrane chip consists of 4 sets of probe sequences and a set of positive control (Positive) probe sequences fixed on the surface of the support membrane in sequence. The 5' end of the probe needs to be modi...
Embodiment 2
[0081] The bovine-derived component detection kit in this example consists of a primer set, a membrane chip, and auxiliary materials. Oligonucleotide single-stranded DNA, the base sequence of positive oligonucleotide single-stranded DNA with biotin mark at the 5' end is biotin-5'-CTGGTACTTTGGA
[0082] CACTCGTTCTTCTCGCACTGCTCATTATTGCTTCTGATCTGGATGC-3'.
[0083] The extracted bovine-derived component DNA is yellow cattle, and the test results are as follows figure 2 Shown in B.
[0084] All the other are the same as embodiment one.
Embodiment 3
[0086] The bovine-derived component DNA extracted in this example is buffalo, and the test results are as follows: image 3 Shown in B.
[0087] All the other are with embodiment two.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com