Kit and method for detecting gene mutation, and applications of method
A kit and genetic technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of low detection sensitivity, sensitivity bottleneck, cumbersome operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0102] The following examples are used herein to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to be employed in the practice of the invention, and thus can be considered preferred modes for its practice. However, those skilled in the art should understand from this specification that many modifications can be made to the specific embodiments disclosed herein, and the same or similar results can still be obtained without departing from the spirit or scope of the present invention.
[0103] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs, and the disclosures cited herein and their cited materials are all incorporated by reference .
[0104] Those skilled in the art will recognize, or ...
Embodiment 2
[0144] Embodiment 2: CODAR-PCR technology is used for BRAF gene V600E mutation detection
[0145] Sample example
[0146] 1. Sample preparation
[0147] Formaldehyde-fixed paraffin-embedded samples (FFPE samples) of melanoma patients, one copy of BRAF gene V600E mutant type and one wild type sample were selected, and DNA and total nucleic acid were extracted from FFPE tissues (DNA / RNA co-extraction) (DNA / RNA co-extraction).
[0148] 2. Amplicon selection
[0149] The amplicon is selected by the present invention, and 85 bases of the amplicon are selected in exon 21 according to the EGFR gene T790M mutant sequence queried by cosmic data.
[0150] GGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGG (SEQ ID NO. 11)
[0151] 3. Primer, probe and blocker design
[0152] Using the present invention to design primers, blockers and probes
[0153] Mutant upstream primer: GGTGATTTTGGTCTAGCTACTGA (SEQ ID NO.12)
[0154] Mutation downstream primer:...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


