Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit and method for detecting gene mutation, and applications of method

A kit and genetic technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of low detection sensitivity, sensitivity bottleneck, cumbersome operation, etc.

Pending Publication Date: 2019-07-05
SHUWEN BIOTECH CO LTD
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although digital PCR technology has the advantages of high sensitivity, high precision, and absolute quantification, the technology needs to be popularized, the development of kits is not easy, and the sensitivity may have bottlenecks. Currently, it is only suitable for transformational research
NGS technology also has shortcomings: expensive; the read length is about 30-250bp, which is shorter than Sanger sequencing, which imposes a burden on sequence splicing; the test results still need to be verified by the gold standard "Sanger sequencing"; for the detection of exon and endon The accuracy of the deletion of small fragments in the sub-container junction region is not enough; it still needs to perform microemulsion PCR amplification on the template to be tested, which is cumbersome and limits the sequencing speed
ARMS technology is currently the mainstream method of gene detection supported by regulations. ARMS technology is highly popular and suitable for widespread use in hospitals. It is simple, fast, and specific. It is the mainstream gene mutation detection product in the current medical market. However, the detection sensitivity of traditional ARMS technology is low. Low (1%), the sensitivity in tissues can meet clinical needs, but the detection in blood is relatively low, which cannot meet the detection of samples with low abundance of mutation target sequences, especially the growing liquid biopsy technology; in addition, traditional ARMS technology can only detect gene mutations in sample DNA or RNA, especially for blood samples, it can only detect free DNA or RNA in plasma / serum, but cannot better detect circulating tumor cells (CTCs) in blood ) nucleic acid, tumor cell-derived exosome (exosome) nucleic acid and other types of samples of mutant genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for detecting gene mutation, and applications of method
  • Kit and method for detecting gene mutation, and applications of method
  • Kit and method for detecting gene mutation, and applications of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0102] The following examples are used herein to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to be employed in the practice of the invention, and thus can be considered preferred modes for its practice. However, those skilled in the art should understand from this specification that many modifications can be made to the specific embodiments disclosed herein, and the same or similar results can still be obtained without departing from the spirit or scope of the present invention.

[0103] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs, and the disclosures cited herein and their cited materials are all incorporated by reference .

[0104] Those skilled in the art will recognize, or ...

Embodiment 2

[0144] Embodiment 2: CODAR-PCR technology is used for BRAF gene V600E mutation detection

[0145] Sample example

[0146] 1. Sample preparation

[0147] Formaldehyde-fixed paraffin-embedded samples (FFPE samples) of melanoma patients, one copy of BRAF gene V600E mutant type and one wild type sample were selected, and DNA and total nucleic acid were extracted from FFPE tissues (DNA / RNA co-extraction) (DNA / RNA co-extraction).

[0148] 2. Amplicon selection

[0149] The amplicon is selected by the present invention, and 85 bases of the amplicon are selected in exon 21 according to the EGFR gene T790M mutant sequence queried by cosmic data.

[0150] GGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGG (SEQ ID NO. 11)

[0151] 3. Primer, probe and blocker design

[0152] Using the present invention to design primers, blockers and probes

[0153] Mutant upstream primer: GGTGATTTTGGTCTAGCTACTGA (SEQ ID NO.12)

[0154] Mutation downstream primer:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection kit and method, and applications of the method, in particular to a kit and method for detecting gene mutation, and applications of the method. The kit comprises apair of first primer group capable of amplifying a DNA sequence of the gene, a pair of second primer group capable of amplifying a reverse transcription product sequence of a gene transcript, and a mixed enzyme consisting of reverse transcriptase for synthesizing DNA by using RNA as a template and DNA polymerase for synthesizing DNA by using DNA as a template. The method can detect mutation sequences in DNA and RNA in a whole blood sample at the same time, can detect trace mutation types by adopting a small number of samples, and greatly meets the requirements of current clinical sample detection, particularly liquid biopsy. Meanwhile, by adjusting the reaction system, the detection sensitivity reaches 0.01%.

Description

technical field [0001] The present invention relates to a detection kit, method and application thereof, in particular to a detection kit, method and application thereof for detecting gene mutation. Background technique [0002] Gene mutation is an abnormal change of genetic material, generally refers to the change of genetic material in a site on the chromosome, that is, the replacement, addition or deletion of DNA base pairs in the long chain of DNA molecules causes changes in the genetic structure. Variety. Gene mutation is the basis of biological evolution and genetic diversity of species populations, and it is also the direct cause of most human genetic diseases, tumors and other susceptible diseases. The detection of gene mutation is an important method for clinical gene diagnosis of genetic diseases and tumors, and is of great significance to the early detection and treatment of diseases. [0003] The study of gene mutation has become one of the hotspots in life sci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6827C12Q1/6883C12Q1/6886C12N15/11
CPCC12Q1/6827C12Q1/6883C12Q1/6886C12Q2600/156C12Q2535/137C12Q2521/107C12Q1/6858C12Q2600/112C12Q2521/101C12Q2525/186C12Q2561/101C12Q1/686C12Q1/6853C12Q1/6806
Inventor 李兴民杨欢欢
Owner SHUWEN BIOTECH CO LTD