Application of tetrahedral skeleton nucleic acid in preparing medicine for skin repairing

A skin repair, tetrahedral technology, applied in the field of medicine, to achieve the effect of promoting migration, promoting skin healing and reducing inflammatory response

Active Publication Date: 2019-07-09
成都腾达树纳米生物科技有限公司
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Tetrahedral backbone nucleic acids are usually used as drug carriers; there are no reports on the application of tetrahedral backbone nucleic acids in skin repair

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of tetrahedral skeleton nucleic acid in preparing medicine for skin repairing
  • Application of tetrahedral skeleton nucleic acid in preparing medicine for skin repairing
  • Application of tetrahedral skeleton nucleic acid in preparing medicine for skin repairing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 4

[0031] Synthesis and Identification of Example 1 Tetrahedral Skeleton Nucleic Acid

[0032] 1. Synthesis method

[0033] Dissolve the four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and rapidly heat to 95 Keep the temperature at ℃ for 10 minutes, then quickly cool down to 4℃ and keep it for more than 20 minutes to obtain tetrahedral skeleton nucleic acid.

[0034] The sequences of the four single strands (5'→3') are as follows:

[0035] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGA

[0036] GACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0037] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTGCTACAC

[0038] GATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0039] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATC

[0040] GACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)

[0041] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATAC

[0042] GAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4)

[0043] 2. Identificati...

Embodiment 2

[0045] Embodiment 2 skin defect repair

[0046] 1. Model animals

[0047] There were 5 SD rats in total. After the back skin was prepared, a circular epithelial full layer with a diameter of 1 cm was taken from the left and right backs with a skin puncher.

[0048] 2. Packet processing

[0049] SD rats were taken as autologous controls, the left side was the control group, and the right side was the experimental group. After the operation to the 7th day after the operation, the wound of the control group was subcutaneously injected with 0.1ml of normal saline in the operation area every day, and the wound of the experimental group was subcutaneously injected with 0.1ml of tetrahedral skeleton nucleic acid (dissolved in normal saline) every day in the wound of the operation area. is 125nM.

[0050] 3. Appearance changes and related index test results

[0051] Take pictures on the 0th, 3rd, 7th, and 14th days and record the wound area, and calculate the wound healing rate = ...

Embodiment 3

[0053] Example 3 Cell scratch experiment

[0054] Inoculate keratinocytes and fibroblasts in 6-well plates (30,000 cells / well) overnight, and use a yellow tip (the tip of a pipette with a capacity of 200 microliters) to draw vertical lines in the wells the next day. Rinse with PBS for 3 times, then add fresh low-serum medium (1% serum), divide into control group (without tetrahedron), 125nM tetrahedron group, 250nM tetrahedron group, take pictures of scratches at 0, 6, and 24h time points of cell migration.

[0055] It can be seen that compared with the control group, the keratinocytes of the 125nM concentration tetrahedron group ( Figure 5 ) and fibroblasts ( Figure 6 ) area of ​​the scratches was significantly reduced, and the cell migration was significantly enhanced. It is believed that the tetrahedron can promote the migration of keratinocytes and fibroblasts.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of medicine, in particular to application of tetrahedral skeleton nucleic acid in preparing medicines for skin repairing. The application of the tetrahedral skeletonnucleic acid in preparing skin repairing medicine is provided, the tetrahedral skeleton nucleic acid is a tetrahedral structure obtained by four single strands of DNA being denatured at 80 DEG C or above and then renatured 10 DEG C or below, and in the tetrahedral structure, the quantity of four single strands of DNA is the same. Accordingly, damaged skin can be effectively repaired, the inflammatory responseand scar formation are reduced, and the tetrahedral skeleton nucleic acid has good application prospects.

Description

technical field [0001] The invention relates to the field of medicines, in particular to the use of tetrahedral skeleton nucleic acids in the preparation of medicines for skin restoration. Background technique [0002] As the first barrier of the human body, the skin is often the most vulnerable to damage by biological, physical, chemical and other factors, resulting in defects, and skin defects will not only cause inflammation and scars, affect the patient's function and appearance, but may also cause a series of psychological problems. disease. Promoting the healing of skin defects has always been one of the focuses of surgeons' research. [0003] Currently, existing technologies for treating skin defects include gene therapy, stem cell therapy, and exosome therapy. Gene therapy mainly relies on viral vectors or non-viral vectors to transcribe growth factor cDNA in skin tissue to produce the required growth factors, thereby promoting the healing of skin defects. Stem ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7088A61P17/02
CPCA61K31/7088A61P17/02
Inventor 林云锋朱君瑶
Owner 成都腾达树纳米生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap