Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers for rapidly detecting sh2sh2 genotype sweet corn and application of primers

A technology for sweet corn and genotype, applied in the field of primers for rapid detection of sh2sh2 genotype sweet corn, can solve the problems of long time, achieve the effect of solving long cycle and improving breeding efficiency

Inactive Publication Date: 2019-08-09
HEBEI AGRICULTURAL UNIV.
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This conventional method of insemination takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers for rapidly detecting sh2sh2 genotype sweet corn and application of primers
  • Primers for rapidly detecting sh2sh2 genotype sweet corn and application of primers
  • Primers for rapidly detecting sh2sh2 genotype sweet corn and application of primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] A primer for rapid detection of sh2sh2 genotype sweet corn, said primer is designed according to the mutation site characteristics of the sh2 sequence as follows figure 1 As shown, the primers include an upstream primer sequence P1 and a downstream primer sequence P2, wherein the nucleotide sequence P1 of the upstream primer is 5'GGCAAAGTAATAACATAAATGGT 3', as shown in SEQ ID No.1, the core of the downstream primer The nucleotide sequence P2 is 5'GGTAAGAAGAAAAAGAAGAAGGA 3', as shown in SEQ ID No.2.

[0035] Such as Figure 1-3 Shown, a kind of fast and accurate method for breeding sweet corn inbred line, comprises the following steps:

[0036] S 1 . Extract the DNA of sweet corn, the specific steps are as follows:

[0037] S 1-1 .65 ℃ preheated CTAB buffer, CTAB buffer contains 1.17mM NaCl, 0.0016mM EDTA pH = 8.0, 0.835mM Ttis-HCl pH = 7.5, 1.6% CTAB, 1% β-mercaptoethanol;

[0038] S 1-2 .Take 0.2g of fresh leaves of sweet corn and place in 1mL step S 1-1 Grind i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers for rapidly detecting sh2sh2 genotype sweet corn and application of the primers. An ordinary corn selfing line can be rapidly transformed into a super-sweet corn selfing line through the primers. The specific primers include the upstream primer with the nucleotide sequence shown as SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown as SEQ ID NO.2. It is shown through tests that by means of the method for breeding the sweet corn selfing line with the aid of molecular markers, plants with the recessive gene sh2 can be directly and rapidly authenticated in the seedling stage, other genotypes are eliminated, unnecessary selfing authentication is greatly omitted, the breeding efficiency is improved, the breeding cycle is shortened, and the novel technology of rapidly and precisely transforming the sweet corn is realized.

Description

technical field [0001] The invention relates to the field of sweet corn breeding, in particular to a primer for rapid detection of sh2sh2 genotype sweet corn and its application. Background technique [0002] Sweet corn is a subspecies of the genus Maize, which originated in the American continent and is an economical crop that integrates grain, fruit, vegetables and feed. Sweet corn is a kind of fresh corn with rich nutrition and unique taste, which is deeply loved by consumers. With the continuous improvement of people's living standards, people's diet structure is also changing to the consumption concept of nutrition, health, green and environmental protection. Under the background of my country's supply-side reform, urban and rural residents have an increasing demand for fresh corn. It is one of the urgent tasks of agricultural research to continuously cultivate high-quality sweet corn varieties and provide more and better high-quality fresh corn to meet people's growi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 段会军崔彦宏刘松涛王亚菲陶勇生
Owner HEBEI AGRICULTURAL UNIV.
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More