Primers for rapidly detecting sh2sh2 genotype sweet corn and application of primers
A technology for sweet corn and genotype, applied in the field of primers for rapid detection of sh2sh2 genotype sweet corn, can solve the problems of long time, achieve the effect of solving long cycle and improving breeding efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] A primer for rapid detection of sh2sh2 genotype sweet corn, said primer is designed according to the mutation site characteristics of the sh2 sequence as follows figure 1 As shown, the primers include an upstream primer sequence P1 and a downstream primer sequence P2, wherein the nucleotide sequence P1 of the upstream primer is 5'GGCAAAGTAATAACATAAATGGT 3', as shown in SEQ ID No.1, the core of the downstream primer The nucleotide sequence P2 is 5'GGTAAGAAGAAAAAGAAGAAGGA 3', as shown in SEQ ID No.2.
[0035] Such as Figure 1-3 Shown, a kind of fast and accurate method for breeding sweet corn inbred line, comprises the following steps:
[0036] S 1 . Extract the DNA of sweet corn, the specific steps are as follows:
[0037] S 1-1 .65 ℃ preheated CTAB buffer, CTAB buffer contains 1.17mM NaCl, 0.0016mM EDTA pH = 8.0, 0.835mM Ttis-HCl pH = 7.5, 1.6% CTAB, 1% β-mercaptoethanol;
[0038] S 1-2 .Take 0.2g of fresh leaves of sweet corn and place in 1mL step S 1-1 Grind i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap